Construction of full-length viral dimer clones
In order to get dimer length fragment of the viral genome, the RCA product was partially digested with EcoRI/ HindIII/ BamHI restriction enzymes with three concentrations each (0.1U, 0.2U and 0.3U) at different incubation periods (5 min/10 min/15 min). Finally with repeated attempts, partial digestion of RCA product (dimer-2x) was yielded successfully with 0.2U of BamH1 restriction enzyme for 10min of the incubation period. This dimer length (5.9 kb) fragment of the viral genome was eluted and ligated into a binary vector pCAMBIA 2301 at BamHI site (Fig 1). Ligated products were transformed into
Escherichia coli (TOP 10) cells. Confirmation of recombinant clones was done by PCR using specific primers designed to DNA-A (
Chattopadhyay et al., 2010; F- GGATCCATTGTTGAACGACTTTCC / R-GGATCCCACATTGTT AGTGGGTTC) and DNA-B of begomoviruses (
Naimuddin et al., 2011; F-ATGGAGAATT ATT CAGGCGCA/ R-TTACAACGCTTTGTTCACATT) and further confirmation was done by restriction digestion analysis with two combinations of restriction enzymes (HindIII / SacI and Pst1/ EcoRI). In our study total of three dimer clones were constructed (MYMV-TPT-A, MYMIV-TPT-A and MYMV-TPT-B) in the pCAMBIA 2301 vector (Fig 2).
Infectivity analysis of constructed viral clones
To test the infectivity, MYMV-TPT-A, MYMIV-TPT-A and MYMV-TPT-B dimer clones were introduced into competent cells of
Agrobacterium tumefaciens (EHA 105) by freeze-thaw method. The presence of the binary vector in
A. tumefaciens was confirmed by PCR using specific primers and restriction digestion analysis.
To confirm the infectivity/ to prove Koch’s postulates for constructed dimer clones, agroinoculation was done in two sets using known susceptible genotype PBG-32. One set of agroinoculation was carried out using
Agrobacterium strains containing MYMV-TPT-A and MYMV-TPT-B dimeric clones and the second set of agroinoculation was done with
Agrobacterium strains containing MYMIV-TPT-A andMYMV-TPT-B dimeric clones. In two experiments, we observed characteristic yellow mosaic symptoms on first emerged trifoliate at 8-12 days after inoculation (DAI). It was confirmed that both DNA-A components (MYMV and MYMIV) are infectious when agroinoculated with one DNA-B component (MYMV) and successfully express the viral genome in the blackgram plant.
The genotypes were observed up to 25-30 days for symptoms expression and percentage incidence of disease was recorded (Table 1). The accumulation of virus was detected by PCR using coat proteinand movement protein specific primers.
In the PCR analysis, virus presence was observed in symptomatic and asymptomatic agroinoculated plants as well as in a few control plants. The differences in band intensity were observed between symptomatic, asymptomatic agroinoculated and control blackgram plants. It is necessary to investigate the fate of the virus in asymptomatic and control plants as there was no symptoms were observed in the total growth period of blackgram plants. It was reported that the presence of MYMV in various parts of blackgram seed like seed coat, cotyledon and embryonic axis was confirmed by different techniques like PCR, southern blot analysis and sequencing. When the growing test was performed with same batch seeds, no symptom development was reported in the seedlings. These results indicate the seed borne nature of the MYMV and it was hypothesized that the robust metabolic environment of a growing seedling may not be favourable to efficient build-up and translocation of the virus
(Kothandaraman et al., 2016). But in greengram, seed borne nature of YMD was contradicted by
Naimuddin et al., 2016. Thus, detailed analysis is still needed to confirm the exact mechanism of the seed-borne nature of YMVs in different
Vigna species (
Mishra et al., 2020). The concentration of virus particles needed for symptom expression in blackgram should be analyzed. Similarly, the relation between virus load and resistance level in plants is to be studied.
Most of the infectious clones of begomovirus were constructed by inserting a fragment containing intergenic region into the end of full-length genome (partial tandem repeat) which usually involve the selection and design of cloning sites, and several subcloning procedures, which is a laborious process. Recently, rolling circle amplification (RCA) technology has been developed for amplification of any circular DNA for research and diagnostic purpose without using PCR. This method generates tandemly repeated conctamers/ viral multimers and partial digestion of these viral multimers with restriction enzymes will generate infectious dimers that can clone into any plant transformation vector without any further sub cloning procedures (
Inoue-Nagata et al., 2004).
Several workers were made infectious partial dimeric clones of geminivirus by RCA method
(Balaji et al., 2004; Bag et al., 2014;
Karthikeyan et al., 2004 and
Jacob et al., 2003). In this study, we successfully generated infectious full dimeric clones (MYMV-TPT-A, MYMIV-TPT-A and MYMV-TPT-B) and further used in the screening experiment. Similarly, infectious complete tandem dimeric construct of Chickpea chlorotic dwarf Pakistan virus associated with chickpea stunt disease was constructed by
Kanakala et al., (2013).
Total of 45 genotypes were screened by the sprouted seed method of agroinoculation. The screening experiment was carried out separately with two combinations of viral clones (MYMV-TPT-A+MYMV-TPT-B and MYMIV-TPT-A+MYMV-TPT-B) to know the resistant response of blackgram genotypes against MYMV and MYMIV infection. The disease rating scale 0-9 was used to categorize the genotypes
(Sudha et al., 2013).
Total of 45 blackgram genotypes were subjected to agroinoculation in two replications with two combinations of viral clones. The agroinoculated blackgram genotypes started showing characteristic yellow mosaic symptoms from 8-25 days of agroinoculation and no symptoms were observed in control plants. The average percent infection of agroinoculated blackgram genotypes ranged between 0-100%. The genotypes from each category (S, HS, MS, MR and R) or disease response of each genotype are given in Table 2. It was observed that, among 45 genotypes, 24 genotypes offered resistance against MYMV infection and 23 genotypes were resistant to MYMIV infection. On the 25
th day, diseased leaf samples were collected for DNA isolation. The isolated DNA samples were analyzed for the presence of viral genome by PCR by coat protein and movement protein specific primers. As described earlier, presence of viral genome was noticed even in a few control plants.
Interestingly, thirteen genotypes namely VBG 12-034, DKU 82, DKU 99, IPU 2-43, PU 11-25, COBG 13-14, LBG-888, OBG-38, DKU-95, TJU 103, ABG-1, ABG-3 and TBG123 showed differential resistant response to agroinoculation with respective DNA-A of MYMV and MYMIV. Among thirteen genotypes, DKU 99 and PU11-25 genotypes were resistant to MYMV infection, but they were highly susceptible to MYMIV infection (Fig 3a-b).Whereas COBG 13-14 and LBG 888 genotypes were susceptible to MYMV infection and showed resistance to MYMIV infection (Fig 3c-d). Finally,17 genotypes
i.e. NDUK 15-222, PU 13-15, KPU 12-213, VBG 12-111, TJU 24, KPU12-1730, KU 16-07, IPU 13-3, DKU 116, KUG 718, IPU 12-30, TBG-138, PU-31, TBG-104, GBG-1,TBG-129 and TBG-125 offered resistance to both species of virus (MYMV andMYMIV). Among these 17 genotypes, TBG 129 and TBG-125 are advanced breeding germplasm developed from RARS, Tirupati. To confirm the results the experiment had repeated once and comparable results were observed. The above results clearly indicated that there is a differential resistant response of genotypes against MYMV and MYMIV infection was noticed. The sequence information of constructed clones might give a clue for this differential resistance response of the genotypes.
A similar type of artificial screening of germplasm by agroinoculation technique was previously done in different hosts like blackgram, greengram, soyabean and cowpea by several workers
(Jacob et al., 2003; Usharani et al., 2004; Karthikeyan et al., 2011; Sudha et al., 2013; Bag et al., 2014; Madhumitha et al., 2022), But all these screening trials were evaluated with DNA-A and DNA-B clones of MYMV. In this study, first time we attempted the screening experiment with clones of MYMIVDNA-A and MYMVDNA-B along with MYMV DNA-A and DNA-B clones.
