Indian Journal of Agricultural Research

  • Chief EditorV. Geethalakshmi

  • Print ISSN 0367-8245

  • Online ISSN 0976-058X

  • NAAS Rating 5.60

  • SJR 0.293

Frequency :
Bi-monthly (February, April, June, August, October and December)
Indexing Services :
BIOSIS Preview, ISI Citation Index, Biological Abstracts, Elsevier (Scopus and Embase), AGRICOLA, Google Scholar, CrossRef, CAB Abstracting Journals, Chemical Abstracts, Indian Science Abstracts, EBSCO Indexing Services, Index Copernicus
Submit

Full Research Article

Indian Journal of Agricultural Research, volume 56 issue 1 (february 2022) : 81-90

Diversity of Colletotrichum Species causing Anthracnose Disease from Mango cv. Nam Dork Mai See Tong based on ISSR-PCR

S. Bincader1,2, R. Pongpisutta1,2, C. Rattanakreetakul1,2
1Department of Plant Pathology, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University, Nakhon Pathom 73140, Thailand.
2Postharvest Technology Innovation Center, Ministry of High Education, Science, Research and Innovation, Bangkok 10400, Thailand.
Cite article:- Bincader S., Pongpisutta R., Rattanakreetakul C. (2022). Diversity of Colletotrichum Species causing Anthracnose Disease from Mango cv. Nam Dork Mai See Tong based on ISSR-PCR . Indian Journal of Agricultural Research. 56(1): 81-90. doi: 10.18805/IJARe.AF-691.

ABSTRACT

Background: Anthracnose disease caused by the genus Colletotrichum is one of the crucial problems occurring in the field, along with postharvest diseases and affects mango quality in Thailand. In particular, the Nam Dork Mai See Tong cultivar, which is highly susceptible to the disease, is an important product for exportation.

Methods: In this research, thirty-seven Colletotrichum species isolate were obtained from anthracnose disease in mango cv. Nam Dork Mai See Tong in three provinces in Thailand. Morphological studies and molecular techniques using species-specific primers were investigated; moreover, the diversity of pathogens was analyzed using PCR amplification of inter simple sequence repeats (ISSRs) with 6 primers, including pathogenicity tests.

Result: Morphological studies and molecular detection with species-specific primers revealed that 32 isolates belonged to the C. gloeosporioides species complex and 5 isolates to the C. acutatum species complex. The genetic diversity of pathogens was analyzed. PCR amplification using 6 ISSR primers produced 35 polymorphic bands. These bands were used to construct UPGMA, in which cluster analysis divided the 37 isolates into 3 main groups and 8 subgroups at 61-73% Jaccard similarity coefficient with cophenetic correlation (r) = 0.6781. The ISSR technique showed the greatest genetic variation among isolates collected from different locations. Hence, a study based on ISSR markers was profitable to investigate the phylogenetic relationship of the genus Colletotrichum. Pathogenicity tests revealed that PC006 (Ca) and CS005 (Cg) showed the highest aggressiveness, with disease incidences of 84.74 and 80.90%, respectively. This study indicates that the diversity of pathogenic Colletotrichum species related to mango plantations in Thailand is increasing.

INTRODUCTION

Colletotrichum is the most important genus of pathogenic plant fungi worldwide, especially in subtropical and tropical regions (Bailey and Jeger, 1992). This disease affects various parts of the mango tree. The symptom of this disease is commonly appears as a depressed black lesion that is subcircular, in which a spore mass develops, there are necrotic lesions on the young leaves and panicles and damage occurs in the mango fruit (Walker et al., 1991; Cannon et al., 2012; Lima et al., 2015). In particular, conidia of the fungus can germinate on most plant surfaces and produce infectious appressoria (Deising et al., 2008).
       
Cannon et al., (2012) studied the current status of genus Colletotrichum species based on morphology and DNA sequence analyses and the research indicated that it was difficult to visualize the interspecific genetic distance between the recognized species. Apart from this, morphological descriptions are mostly from agar cultures, conidia size and shape, including appressorium formation, using a slide culture technique. Schena et al., (2013) reported that the characteristics of Colletotrichum species can change under different growth conditions and can be lost with repeated subculturing.
       
In many instances, genetic recombination is constrained, such as mycelia or vegetative incompatibility in asexual pathogen populations producing clonal population structures. Molecular analyses, such as RAPD (random amplification of polymorphic DNA), RFLP (restriction fragment length polymorphism) and ISSR (inter simple sequence repeat), have demonstrated occasional transfer of specific chromosomes between apparently genetically distinct isolated clonal lines and the production of newpathotypes on different host plants (Masel et al., 1996). ISSR markers are a simple rapid technique using a single primer for detection and random amplification, such as RAPD. Primers are designed to amplify the regions between microsatellite loci even using a single primer and thus generate highly polymorphic patterns between different individuals (Mort et al., 2003; Hettwer and Gerowitt, 2004). The objectives of this study were to reveal the relationship of Colletotrichum species causing mango anthracnose disease in the Nam Dork Mai See Tong cultivar using ISSR-PCR.

MATERIALS AND METHODS

Fungal isolation
 
The fungal pathogen was isolated from mango anthracnose symptoms using a tissue transplanting technique. A small piece (5×5 mm in size) of infected tissue was cut from the edge of the anthracnose lesion. The surface disinfected with 1.2% sodium hypochloride for 3 min and was then rinsed 3 times using sterile distilled water. The tissue was wiped and allowed to air dry, placed on the surface of potato dextrose agar (PDA) and later incubated at 25°C under a 12 hr light/12 hr dark photoperiod for 5 days to induce mycelial development. The fungus was purified using a single spore isolation technique on water agar (WA) and mycelia were transferred onto potato carrot agar (PCA) for further study.
 
Morphological identification
 
Morphological characteristics were described by Sutton (1980). Each petri dish containing 15 mL of PDA was inoculated with one mycelial disc 5 mm in diameter from the margins of the 5-day-old colonies growing on PDA and then incubated at 25°C under a 12 hr light/12 hr dark photoperiod. Colony type and spore mass color were evaluated at day 5 and the length and width of thirty conidia were measured. An appressorium study was induced by a modified slide culture technique (Johnston and Jones, 1997). Each isolate with a 5-day-old culture on PDA was transferred onto a 25.4×76.2 mm sterile microscope slide, covered with a 22×22 mm cover slide and incubated at 25°C for 4 days in a petri dish as a moisture chamber. The length and width of 30 appressoria per isolate were measured under a compound microscope with Olympus CellSens Standard software version 1.6.
 
DNA extraction
 
The method of total genomic DNA extraction was performed according to the modified protocol of Pongpisutta et al., (2013). Colletotrichum species were grown in spezieller nährstoffarmer broth (SNB) at room temperature for 48-72 hr. Mycelia were harvested by filter paper (Whatman No. 1) and crushed in liquid nitrogen. Then, 50 mg of mycelium powder was suspended in a 1.5-mL microcentrifuge tube containing 500 μl extraction buffer and 2.8 µL proteinase K. The mixture was incubated at 65°C for 1 hr then 250 µL phenol chloroform isoamyl alcohol (25:24:1) was added and mixed with vortex and centrifuge for 10 min at 13,000 rpm. A 400 µL aliquot of the supernatant was transferred to a new sterile microcentrifuge tube. Sedimentation of genomic DNA was performed using 800 µL chilled absolute alcohol incubated at -20°C for 1 hr and then centrifugation at 13,000 rpm for 10 min was used to sediment pellets of the genomic DNA. The resulting pellet was washed with 70% ethanol, centrifuged at 13,000 rpm for 10 min (2 times), allowed to dry at room temperature and then dissolved in 70 µL of 1X TE buffer. Agarose gel electrophoresis was used at a concentration of 1.2% to evaluate DNA quantity and quality by comparison with a 100 bp GeneRuler DNA Ladder.
 
PCR amplification using species-specific primers
 
DNA templates were amplified by PCR using specific primers CaInt2 (5'GGGGAAGCCTCTCGCGG'3) (Sreenivasaprasad et al., 1996) /ITS4 (5'TCCTCCGCTTATTGATATGC'3) (White et al., 1990) and CgInt (5'GG CCTCCCGCCTCCGGGCGG'3) (Mills et al., 1992) /ITS4 (5'TCCTCCGCTTATTGATATGC'3) (White et al., 1990). PCR was performed in a 25 μl total volume containing 20 ng of DNA template, 1X Dream Taq buffer MgCl2, 2 mM dNTPs, 400 nm of each primer and 1 U of Dream Taq DNA polymerase (Fermentas Co., Ltd.). PCR conditions were carried out in a programmable thermal cycler as follows: pre-denaturation at 94°C for 2 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s and extension at 72°C for 1 min and a final extension step of 72°C for 10 min. PCR products were verified by 1.2% agarose gel electrophoresis in 1X TBE buffer with a 100-volt electronic current. The DNA bands were visualized under UV light using gel documentation (Syngene Co., Ltd.).
 
Inter simple sequence repeat-PCR (ISSR-PCR)
 
ISSR-PCR was performed in a 25 µl PCR containing 25 ng/µl DNA template, 10X Taq buffer, 2 mM MgCl2, 1 mM dNTPs, 10 µM single primer and 5 U/µl Taq polymerase. PCR was carried out using TProfessional Standard Gradient (Biometra Co., Ltd.) under the following conditions: 94°C for 5 min, then 40 cycles of 94°C for 20 sec, annealing of each primer (described in Table 1) for 45 sec, 72°C for 1 min and a final extension at 72°C for 3 min. PCR products were verified by 1.4% agarose gel electrophoresis in 1X TBE buffer with a 80-volt electronic current. The polymorphic bands of the products were visualized under UV light and photographed using gel documentation. Polymorphic bands of each primer were recorded by using binary data with 1= presentand 0= absent. The data were analyzed with NTSYSpc version 2.20e (Rohlf, 1988). Cluster analysis was performed using the Jaccard similarity coefficient and grouping by the unweighted pair-group method with averages (UPGMA). A dendrogram was generated with the cophenetic correlation (r) (Rohlf and Sokal, 1981). Bootstrap values were calculated with 1,000 replicates using Winboot (Yap and Nelson, 1996).
 

Table 1: Primer used in this study, with sequences.


 
Pathogenicity test
Representative isolates of the Colletotrichum species complex were selected for pathogenicity testing on immature mango fruits (cv. Nam Dork Mai See Tong) under laboratory conditions. All isolates were cultured on PDA and incubated at 25°C under a 12 hr light/12 hr dark photoperiod for 5 days. The colony margin was then cut with a cork borer and 5-mm mycelial discs were transferred onto mango fruits that were previously washed with 1.2% sodium hypochlorite for 1 min and rinsed twice with sterile distilled water. Inoculated fruits were used with the unwounded technique, kept in a moisture box and incubated at room temperature under a 12 hr light/12 hr dark photoperiod for 5 days. Symptom development was examined. The experimental design was analyzed by R-stat X64 3.4.0 software using a completely randomized design (CRD). Analysis of variance (ANOVA) and Duncan’s multiple range test (DMRT) were used to detect statistical significance and differences were considered significant when P<0.05. Five replications were used in each isolate for this study.

RESULTS AND DISCUSSION

Fungal isolation
 
A total of 37 isolates were recovered from diseased samples showing typical anthracnose symptoms on the inflorescences, leaves and fruits both pre- and postharvest. All parts of the inflorescences are susceptible to Colletotrichum species with dark-brown spots and elongated dark lesions that enlarge and coalesce and then, the infected flower parts fall off the inflorescences. The infection of the leaves starts as small brown to black spots, often with a distinct yellow halo, that enlarge to irregular lesions with brown-gray to black necrotic spots on the leaf surfaces. While infection of mature fruits appears as small dark circular spots becoming sunken lesions, prior to ripening, the lesions are black and expand rapidly in size, producing acervuli with different colors of conidial masses under high relative humidity (Fig 1a-1c). All Colletotrichum isolates were isolated from mangos cv. Nam Dork Mai See Tong, which were collected from 3 provinces in Thailand: Chachoengsao, Ratchaburi and Phichit, containing 10, 15 and 12 fungal pathogens, respectively (Table 2).
 

Fig 1: Anthracnose symptoms from mango plantations in 3 provinces of Thailand (a-c) and the morphological characteristics of the colonies, conidia and appressoria of the mango.


 

Table 2: Details of isolates, including geographical information, from anthracnose legions on mango cv. Nam Dork Mai See Thong from 3 provinces in central Thailand.


       
Generally, anthracnose disease can invade preharvest in leaves, shoots, inflorescences and fruits, including postharvest (latent infection) fruits. The postharvest phase is the most damaging and economically significant phase of the disease worldwide. This disease stage directly affects the marketability of the fruit, rendering it worthless. Akem (2006) found that anthracnose is recognized as the most important disease in mangos, especially where high humidity prevails during the cropping season and directly affects marketability of the fruit. Apart from this, the study by Ploetz et al., (1994) explained that mango anthracnose disease is found in all mango product areas of the world and is most important where high rainfall and humidity occur. Although some mango cultivars possess moderate resistance to anthracnose, but cv. Nam Dork Mai See Tong is different according to the report by Sangchote (1987) and the Department of Agriculture and Fisheries, Queensland (2014), which described the mango cv. Nam Dork Mai group to be more susceptible to fungal diseases, such as Botryosphaeria spp., Lasiodiplodia theobromae andColletotrichum. The major mango cultivars in Thailand are Nam Dork Mai No.4 and Nam Dork Mai See Tong, which is spread throughout the country. Hence, anthracnose disease is a very common disease in mango production. The distribution of mango anthracnose in Thailand is in several important mango product areas, such as Phitsanulok, Chiang Mai, Prachuap Khiri Khan, Suphan Buri, Phetchabun, Chachoengsao, Phichit and Ratchaburi (Thailand’s Department of Agricultural Extension, 2018). In the field, anthracnose can cause a direct loss of fruit quality, leading to a loss of the mango fruits. Therefore, field management is crucial to control mango anthracnose to reduce severe decline in fruit quality and to assure customer satisfaction.
 
Fungal identification
 
Based on morphological and colony characteristics, a total of 37 isolates were divided into 2 groups, of which 5 isolates were identified as C. acutatum with white to gray mycelia covered with orange to bright orange conidial masses (Fig 1d-1e); the conidia were hyaline, single celled and cylindrical to clavate constricted at the middle being rounded at one end and tapered at the other (3.29-6.57×9.91-22.79 µm) (Fig 1f), setae absent; the appressoria were mostly single, medium brown, smoot-walled, ellipsoidal to obovate sometimes undulate (2.30-7.92´4.42-12.69 µm) (Fig 1g-1j). Thirty-two isolates were identified as C. gloeosporioides with white, gray to green olive cottony aerial mycelia and pale to orange salmon conidial masses (Fig 1k-1l); conidia hyaline, 1 cell, straight to cylindrical with round shapes at both ends (3.59-6.91×11.02-19.52 µm) (Fig 1m) and the appressoria varied in shape, deeply lobed to irregular shapes (4.37-7.31×6.49-11.59 µm) (Fig 1n-1q).
       
Additionally, PCR assays confirmed the morphological identification of Colletotrichum in both species. Species-specific primer sets using CaInt2/ITS4 and CgInt/ITS4 were designed to prosperously distinguish between C. acutatum and C. gloeosporioides. Of the 37 isolates evaluated, 32 were positive for C. gloeosporioides when the CgInt/ITS4 primers were applied, while only 5 (isolates RB014 from Ratchaburi and PC006, PC007, PC011 and PC012 from Phichit) were positive for C. acutatum when CaInt2/ITS4 was used. PCR products of approximately 500 bp in both species were obtained and visualized in an agarose electrophoresis gel (Table 2). Furthermore, molecular identification was similar to that based on morphological characteristics.
 
 
Many researchers have reported that anthracnose caused by Colletotrichum is one of the most severe diseases in mangos. In particular, C. gloeosporioides has been reported to be one of the dominant pathogens infecting mangos in Thailand. Later, it was revealed that other species of Colletotrichum, such as C. acutatum, C. asianum and C. siamense, also attacked mangos (Đinh et al., 2003; Than et al., 2008; Prihastuti et al., 2009; Rungjindamai, 2016; Pongpisutta et al., 2019).
 
Inter simple sequence repeat-PCR (ISSR-PCR)
 
Six ISSR primers were used to reveal the genetic diversity of Colletotrichum species causing mango anthracnose and all primers produced interpretable and variable banding patterns (Table 3). These primers amplified 46 total DNA bands and 35 polymorphic bands from 37 isolates with sizes ranging from 200 to 2,500 bp (Fig 2). The number of total bands scored per primer ranged from 5 (GACA4) to 11 (GTG5), with an average of 8 bands (Table 3). The most informative primers were CAG5, GCA5 and GTG5 generating 100% polymorphic loci (PL), whereas the least informative primer was GACA4 producing 72.97% polymorphic loci (Table 3).
 

Fig 2: DNA fingerprinting on 1.4% agarose gel electrophoresis obtained by ISSR primers AG8C, CAG5, GACA4, GCA5, GTG5 and TCC5.


 

Table 3: Frequency of bands and alleles and estimated population diversity for binary data using GenAIEx software version 6.5.


       
Certainly, the number of polymorphic loci and percentage of polymorphic loci (PPL) are important factors that affect the level of genetic variation in a population. When using ISSR markers, values for the observed number of alleles (Na), effective number of alleles (Ne) and genetic diversity (h) within the 37 isolates are important indicators that influence the level of genetic variation in the population found. Dominant primers were able to detect the highest level of variability, which was demonstrated by the highest values, such as CAG5 (Na=2.0000, Ne=1.8418, h=0.4530) and GTG5 (Na=2.0000, Ne=1.7391, h=0.4137), compared to other markers. The values were calculated by using GenAlEx software version 6.5 (Table 3).
       
Based on the ISSR-PCR products, the dendrogram clustered all the isolates (from 3 geographic populations) into 3 main groups and 8 subgroups at similarity coefficients ranging from 61 to 73% with a 100% bootstrap value and a cophenetic value of (r) = 0.6781. The C. gloeosporioides species complex represented 7 subgroups showing higher variation than the C. acutatum species complex, which found only 1 subgroup (Fig 3). Analysis of diversity is an important platform to understand the development and evolution of pathogen populations, in particular the genus Colletotrichum, which can invade various plants. ISSR-PCR is one of the techniques for detection (McDonald et al., 1997) because of the multilocus fingerprinting profiles obtained. ISSR analysis can be applied in several investigations concerning genetic identity, parentage, clone and strain identification and pathogen taxonomy of closely related species. In addition, ISSRs are considered useful in gene mapping studies (Zietkiewicz et al., 1994; Godwin et al., 1997; Katkar et al., 2015; Abirami et al., 2018; Prasannan and Jose, 2021) including application markers for selection of plant disease resistance variety (Babayeva et al., 2018). However, the isolates of each subgroup blended from different geographicorigins were observed. There was no correlation between genetic diversity and geographical origins, in contrast to the report by Palacýoðlu et al., (2020), which found that the isolates of C. lindemuthianum causing Turkish bean anthracnose belonging to the same geographic origin were observed to be more closely related to one another.
 

Fig 3: UPGMA dendrogram constructed using NTSYS pc (version 2.02) for 37 isolates from Colletotrichum species (3 provinces) using ISSR data and Jaccard’s coefficient (r = 0.6781).


       
The statistical results showed the percentage of variation within the population of these genera with a high level of genetic differentiation. Additionally, in Thailand, the genus Colletotrichum has been reported to have a high level of population differentiation and genetic diversity, such as C. capsici or C. gloeosporioides causing chilli anthracnose (Ratanacherdchai et al., 2010; Rodkate, 2012). There may be multiple clarifications for this event; for example, dispersal, wind currents and other abiotic factors (e.g., geographical isolation) play roles in the dissemination of spores and infected fruits/plant parts and agricultural systems play an important role, there by resulting in gene exchange within populations (Freeman et al., 2013). The difference within the populations indicated that genetic recombination in pathogen reproduction may play an important role in the population evolution of C. gloeosporioides in Thailand. In particular, conidial anastomosis between different strains may contribute to a high level of genetic diversity within the population. Additionally, the levels of genetic diversity observed between the isolates within the same population may be attributed to sexual recombination and the parasexual cycle, which play a role in the life cycle of the pathogen (Padder et al., 2017).
       
Therefore, genetic diversity studies using ISSR markers are reliable and effective tools. The results showed that the C. gloeosporioides species complex occupied a high level of genetic polymorphism and clustered into 2 main groups and 7 subgroups.
 
Pathogenicity test
 
Pathogenicity was tested using Koch’s postulates for all C. gloeosporioides and C. acutatum isolates. These isolates all caused sunken spots and dark brown to brown lesions at Day 5 after the inoculation period. Ten C. gloeosporioides isolates (CS001, CS005, CS006, CS007, CS010, RB001, RB002, RB009, RB010 and PC001) and 2 C. acutatum isolates (PC006 and PC007) caused the most severe symptoms, with level 3 disease incidence in particular. PC006 (Ca) and CS005 (Cg) showed the highest aggressiveness with disease incidences of 84.74 and 80.90%, respectively. However, there were few visible symptoms, with level 1 disease incidence from 13 C. gloeosporioides isolates (CS009, RB003, RB004, RB006, RB007, RB008, RB012, RB013, PC002, PC004, PC005, PC009 and PC010) and 3 C. acutatum isolates (RB014, PC011 and PC012). The isolates representing the lowest disease incidence, PC011 (Ca) and RB004 (Cg), had disease incidences of 8.42 and 6.13%, respectively (Table 2; Fig 4).
 

Fig 4: Disease severity levels on mango fruits cv. Nam Dork Mai See Tong after 5 days of inoculation with mycelium plugs of Colletotrichum species using the unwounded technique.


       
The predominance of C. gloeosporioides (31.25%) and C. acutatum (40%) in the mango anthracnose pathogen population from 3 provinces in Thailand can be attributed to their high levels of pathogenicity and aggressiveness. Although, C. acutatum was found in only 5 isolates in mango plantations in Ratchaburi and Phichit provinces, 40% of the population exhibited aggressiveness higher than the population of C. gloeosporioides. Temperature is among the key environmental factors affecting pathogen survival. Culture of Colletotrichum on PDA in both species was performed at 25-30°C under a 12 hr light/12 photoperiod hr dark for 5 days. Mycelial growth was measured and the growth diameter of C. gloeosporioides was found to be greater than that of C. acutatum. However, there was no correlation between the diversity and geographical origin or aggressiveness and this research found that PC006 (Ca) showed more aggressiveness than CS005 (Cg). Similar to some reports, several Colletotrichum spp. were found to have the capacity to cause strawberry anthracnose in temperate regions (Damm et al., 2012; Weir et al., 2012). Chung et al., (2020) found that the predominance of C. siamense (75%) and C. fructicola (11%) in the strawberry anthracnose pathogen population in Taiwan can be attributed to their higher levels of pathogenicity and aggressiveness. Due to rising global temperatures, it will be particularly imperative to monitor the dissemination of C. acutatum toward mango plantations in Thailand. The results provide precise information about pathogen identification, which is valuable for the development of effective disease management strategies.

CONCLUSION

Anthracnose is a crucial limiting factor for mango production in Thailand and many other areas in the world. This study demonstrated the diversity of pathogenic Colletotrichum species associated with mango cv. Nam Dork Mai See Tong obtained from 3 provinces in Thailand. Regarding nonwounded fruit inoculation, the predominant pathogens were found in both species; C. gloeosporioides and C. acutatum caused larger lesions with 50-100% disease incidence with 31.25 and 40% of each species population, respectively. ISSR markers were reliable and effective tools for determining the diversity of Colletotrichum species and higher diversity was found in C. gloeosporioides than in C. acutatum. Moreover, there was no correlation between diversity and geographical origin or aggressiveness. This research will lead to the development of effective disease management strategies. Future work will focus on investigating the sensitivity of different Colletotrichum species to various levels of fungicide.

ACKNOWLEDGEMENT

This research was funded by the Postharvest Technology Innovation Center, Ministry of Higher Education, Science, Research and Innovation, Bangkok, Thailand. [Grant No. CRP.3. NOV11.8]. We would also like to thank the Mycology Laboratory and Physiology of Plant Disease Laboratory, Department of Plant Pathology, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University, Kamphaeng Saen Campus, Nakhon Pathom, Thailand for their laboratory equipment in plant pathology support.

REFERENCES


  1. Abirami, K., Baskaran, V. and Simhachalam, P. (2018). ISSR marker-based diversity assessment of Piper spp. in Bay Islands, India. Indian Journal of Agricultural Research. 52: 434-438. doi: https://doi.org/10.18805/IJARe.A-4941.

  2. Akem, C.N. (2006). Mango anthracnose disease: Present status and future research priorities. Plant Pathology Journal. 5: 266-273. doi: http://10.3923/ppj.2006.266.273.

  3. Babayeva, S.M., Nasibova, J.A., Akparov, Z.I. Shikhaliyeva, K.B., Mammadova, A.D., Izzatullayeva, V.I. and Abbasov, M.A. (2018). Application of DNA markers in determination of fusarium resistance and genetic diversity in chickpea. Legume Research. 41(4): 537-542. doi: https://doi.org/10.18805/LR-407. 

  4. Bailey, J.A. and Jeger, M.J. (1992). Colletotrichum: Biology, pathology and control. CAB International: Wallingford, UK.

  5. Cannon, P.F., Damm, U., Johnston, P.R. and Weir, B.S. (2012). Colletotrichum- Current status and future directions. Studies in Mycology. 73: 181-213. doi: https://doi.org/10.3114%2Fsim0014.

  6. Chung, P.C., Wu, H.Y., Wang, Y.W., Ariyawansa, H.A., Hu, H.P., Hung, T.H., Tzean, S.S. and Chung, C.L. (2020). Diversity and pathogenicity of Colletotrichum species causing strawberry anthracnose in Taiwan and description of a new species, Colletotrichum miaoliense sp. nov. Scientific Reports. 10: 14664. doi: https://doi.org/10.1038/s41598-020-70878-2https://www.doi.org/10.1038/s41598-020-70878-2. 

  7. Corkidi, G., Balderas-Ruiz, K.A., Taboada, B., Serrano-Carreon, L. and Galindo, E. (2006). Assessing mango anthracnose using a new three-dimensional image-analysis technique to quantify lesions on fruit. Plant Pathology. 55: 250-257. doi: https://doi.org/10.1111/j.1365-3059.2005.01321.x.

  8. Damm, U., Cannon, P.F., Woudenberg, J.H.C. and Crous, P.W. (2012). The Colletotrichum acutatum species complex. Studies in Mycology. 73: 37-113. doi: http://10.3114/sim00 10. 

  9. Deising, H.B., Reimann, S. and Pascholati, S.F. (2008). Mechanisms and significance of fungicide resistance. Brazilian Journal of Microbiology. 39(2): 286-295. doi: https://doi.org/10.1590%2FS1517-838220080002000017.

  10. Department of Agriculture and Fisheries, Queensland. (2014). Nam Doc Mai. https://www.daf.qld.gov.au/business-priorities/agriculture/plants/fruit-vegetable/fruit-vegetable-crops/ mangoes/mango-varieties/nam-doc-mai. (Accessed on 01 August 2021).

  11. Ðinh, Q., Chongwungse, J., Pongam, P and, Sangchote, S. (2003). Fruit infection by Colletotrichum gloeosporioides and anthracnose resistance of some mango cultivars in Thailand. Australasian Plant Pathology. 32: 533-538. doi:  https://doi.org/10.1071/AP03053.

  12. Freeman, S., Horowitz-Brown, S., Afanador-Kafuri, L., Maymon, M. and Minz, D. (2013). Colletotrichum: host specificity and pathogenicity on selected tropical and subtropical crops. Acta Horticulturae. 975: 209-216. doi: http://10.17660/ActaHortic.2013.975.22.

  13. Godwin, I.D., Aitken, E.A.B. and Smith, L.W. (1997). Application of inter simple sequence repeat (ISSR) markers to plant genetics. Electrophoresis. 18: 1524-1528. doi: http://10.1002/elps.1150180906.

  14. Hettwer, U. and Gerowitt, B. (2004). An investigation of genetic variation in Cirsium arvense field patches. Weed Research. 44: 289-297.doi: http://10.1111/J.1365-3180.2004.004 02.X.

  15. Johnston, P. and Jones, D. (1997). Relationships among Colletotrichum isolates from fruit-rots assessed using rDNA sequences. Mycologia. 89: 420-430. https://doi.org/10.1080/00275514.1997.12026801.

  16. Katkar, M., Mane, S.S. and Kadam, N. (2015). Molecular characterization races of Fusarium oxysporum f.sp. ciceri using RAPD and ISSR markers. Legume Research. 38(2): 246-252. doi: http://10.5958/0976-0571.2015.00083.1. 

  17. Lima, N.B., Lima, W.G., Tovar-Pedraza, J.M., Michereff, S.J. and Câmara M.P.S. (2015). Comparative epidemiology of Colletotrichum species from mango in northeastern Brazil. European Journal of Plant Pathology. 141: 679- 688. doi: http://10.1007/s10658-014-0570-y.

  18. Masel, A.M., He, C., Poplawski, A.M., Irwin, J.A.G. and Manners, J.M. (1996). Molecular evidence for chromosome transfer between biotypes of Colletotrichum gloeosporioides. Molecular Plant-Microbe Interactions. 5: 339-348. doi: http://10.1094/MPMI-9-0339.

  19. McDonald, B.A. (1997). The population genetics of fungi: Tools and techniques. Physiopathology. 87(4): 448-453. doi: http://10.1094/PHYTO.1997.87.4.448.

  20. Mills, P.R., Sreenivasaprasad, S. and Brown, A.E. (1992). Detection and differentiation of Colletotrichum gloeosporioides isolates using PCR. FEMS Microbiology Letters. 98: 137- 143. https://doi.org/10.1111/j.1574-6968.1992.tb05503.x.

  21. Mort, M.E., Crawford, D.J., Santos-Guerra, A., Francisco-Ortega, J., Esselman, E.J. and Wolfe, A.D. (2003). Relationships among the macaronesian members of Tolpis (Asteraceae: Lactuceae) based upon analyses of inter-simple sequence repeat (ISSR) markers. Taxon. 52: 511-518. doi: https://doi.org/10.2307/3647449.

  22. Padder, B.A., Sharma, P.N., Awale, H.E. and Kelly, J.D. (2017). Colletotrichum lindemuthianum, the causal agent of bean anthracnose. Journal of Plant Pathology. 99(2): 317-330. doi: http://dx.doi.org/10.4454/jpp.v99i2.3867.

  23. Palacıoğlu, G., Bayraktar, H. and Özer, G. (2020). Genetic variability of Colletotrichum lindemuthianum isolates from Turkey and resistance of Turkish bean cultivars. Spanish Journal of Agricultural Research. 18(3): 1-12. http://10.5424/sjar/2020183-16398.

  24. Ploetz, R.C., Zentmeyer, G.A., Nishijima W.T., Rohrbach, K.G. and Ohr, H.D. (1994). Compendium of tropical fruit diseases. APS Press. St. Paul, Minnesota, US.

  25. Pongpisutta, R., Rattanakreetakul, C. and Bincader, S. (2019). Responsiveness to fungicide chemicals of Colletotrichum gloeosporioides and Colletotrichum siamense associated with postharvest disease of mango. Agricultural Science Journal. 50: 3(Suppl.): 175-178. https://doi.org/10.13140/ RG.2.2.27854.82244.

  26. Pongpisutta, R., Winyarat, W. and Rattanakreetakul, C. (2013). RFLP identification of Colletotrichum species isolated from chilli in Thailand. Acta Horticulturae. 973: 181-186. https://doi.org/10.17660/ActaHortic.2013.973.24.

  27. Prasannan, A. and Jose, S. (2021). Assessment of ISSR markers for tagging genetic variability for yield components in small cardamom (Elettaria cardamomum Maton). Indian Journal of Agricultural Research. 55(2): 212-216. doi: http://10.18805/IJARe.A-5414. 

  28. Prihastuti, H., McKenzie, E., Hyde, K., Cai, L., Chen, H., McKenzie, E.H.C. and Hyde, K.D. (2009). Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Diversity. 39: 89-109.

  29. Ratanacherdchai, K., Wang, H.K., Lin, F.C. and Soytong, K. (2010). ISSR for comparison of cross-inoculation potential of Colletotrichum capsici causing chilli anthracnose. African Journal of Microbiology Research. 4: 76-83.

  30. Rodkate, C. (2012). Variation of Colletotrichum gloeosporioides causing chilli anthracnose. Master Degree Thesis (Plant Pathology), Kasetsart University. Bangkok, Thailand.

  31. Rohlf, F. (1988). NTSYS-pc - Numerical taxonomy and multivariate analysis system. Applied Biostatistics Inc. New York, US.

  32. Rohlf, F.J. and Sokal, R.R. (1981). Comparing numerical taxonomic studies. Systematic Biology. 30(4): 459-490. doi: http://10.1093/sysbio/30.4.459.

  33. Rungjindamai, N. (2016). Isolation and evaluation of biocontrol agents in controlling anthracnose disease of mango in Thailand. Journal of Plant Protection Research. 56: 306-311. doi: https://doi.org/10.1515/jppr-2016-0034.

  34. Sangchote, S. (1987). Postharvest diseases of mango fruits and their losses. Kasetsart Journal, Natural Sciences. 21(1): 81-85.  

  35. Schena, L., Mosca, S., Cacciola, S.O., Faedda, R., Sanzani, S., Agosteo, G., et al. (2013). Species of the Colletotrichum gloeosporioides and C. boninense complexes associated to olive anthracnose. Plant Pathology. 63: 437-446. https://doi.org/10.1111/ppa.12110.

  36. Sreenivasaprasad, S., Sharada, K., Brown, A.E. and Mills, P.R. (1996). PCR-based detection of Colletotrichum acutatum on strawberry. Plant Pathology. 45: 650-655. https://doi.org/10.1046/j.1365-3059.1996.d01-3.x.

  37. Sutton, B.C. (1980). The Coelomycetes: fungi imperfecti with pycnidia, acervuli and stromata. Commonwealth Mycological Institute: Kew, UK.

  38. Thailand’s Department of Agricultural Extension. (2018). https://www.oae.go.th/assets/portals/1/files/ebook/2563/ commodity2562.pdf. (Accessed on 27 July 2021).

  39. Than, P.P., Jeewon, R., Hyde, K.D., Pongsupasamit, S., Mongkolporn, O. and Taylor, P.W.J. (2008). Characterization and pathogenicity of Colletotrichum species associated with anthracnose on chilli (Capsicum spp.) in Thailand. Plant Pathology. 57: 562-572. doi: https://doi.org/10.1111/j.1365-3059.2007.01782.x.

  40. Walker, J., Nikandrow, A. and Millar, G.D. (1991). Species of Colletotrichum on Xanthium (asteraceae) with comments on some taxonomic and nomenclatural problems in Colletotrichum. Mycological Research. 95(10): 1175- 1193. doi: https://doi.org/10.1016/S0953-7562(09)80008-7.

  41. Weir, B. S., Johnston, P. R. and Damm, U. (2012). The Colletotrichum gloeosporioides species complex. Studies in Mycology. 73: 115-180. doi: https://doi.org/10.3114/sim 0011. 

  42. White, T.J, Bruns, T., Lee, S. and Taylor, J. (1990). Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: PCR Protocols: A Guide to Method and Application [M.A. Innis, D.H. Gelfand, J. Sninsky, T.J. White (Eds.)], Academic Press: New York, US.

  43. Yap, I. and Nelson, R.J. 1996. Winboot: A Program for Performing Bootstrap: Analysis of Binary Data to Determine the Confidence Limits of UPGMA based Dendrograms. International Rice Research Institute. Manila, Philippines.

  44. Zietkiewicz, E., Rafalski, A. and Labuda, D. (1994). Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics. 20: 176-183. doi: http://10.1006/geno.1994.1151.
Reviewed By

Download Article
In this Article
    Contact us
    Follow us

    Editorial Board

    View all (0)