Agricultural Science Digest

  • Chief EditorArvind kumar

  • Print ISSN 0253-150X

  • Online ISSN 0976-0547

  • NAAS Rating 5.52

  • SJR 0.176, CiteScore: 0.357

Frequency :
Bi-monthly (February, April, June, August, October and December)
Indexing Services :
BIOSIS Preview, Biological Abstracts, Elsevier (Scopus and Embase), AGRICOLA, Google Scholar, CrossRef, CAB Abstracting Journals, Chemical Abstracts, Indian Science Abstracts, EBSCO Indexing Services, Index Copernicus
Agricultural Science Digest, volume 43 issue 4 (august 2023) : 437-441

In-silico Analysis for Prediction of Mutational Position and Designing of sgRNA for HDT701 Gene in Indian Rice cv. RPBio-226

Shravya Mathsyaraja1, Lavudi Saida1,*, Vutukuri Prathap Reddy1,2
1Department of Biotechnology, Jawaharlal Nehru Technological University, Kukatpally, Hyderabad-500 085, Telangana, India.
2PRR Biotech Innovations Pvt. Ltd., Mehdipatnam, Hyderabad-500 028, Telangana, India
Cite article:- Mathsyaraja Shravya, Saida Lavudi, Reddy Prathap Vutukuri (2023). In-silico Analysis for Prediction of Mutational Position and Designing of sgRNA for HDT701 Gene in Indian Rice cv. RPBio-226 . Agricultural Science Digest. 43(4): 437-441. doi: 10.18805/ag.D-5713.
Background: In eukaryotes, Histone acetylation and deacetylation plays a prominent role in controlling gene expression and chromatin structure modifications. Both Histone acetyltransferases (HAT) and Histone deacetylases (HDACs) work in opposition to regulate chromatin acetylation. Reduced levels of histone H4 acetylation and increased susceptibility to the rice disease M. oryzae result from overexpression of HDT701 in rice. By changing the levels of histone H4 acetylation in defense-related and pattern recognition receptor (PRR) genes in rice, HDT701 reduces the activity of innate immunity which promotes resistance to M. oryzae. Crispr cas9 technology was created to change genes and modify characteristics, as well as to produce resistance to a variety of infections by focusing on possible biomolecules involved in plant defense mechanisms. Therefore the present study was aimed to design single guided RNA (sgRNA) and predict the gene mutational position in the HDT gene in RPBio-226 rice cv.

Methods: To begin with, the DNA was isolated using CTAB method. Specific pair of primers was designed from the reference gene for amplification of HDT gene. In addition to, the PCR product was sequenced and the resulting sequence was applied to the creation of sgRNA. Furthermore, CHOPCHOP is a Bioinformatic search tool used to identify CRISPR–Cas single guide RNA (sgRNA) targets.
Result: The isolated genomic DNA was quantified using nanodrop and found that the concentration of the DNA was 800-1000 ng/ul with the purity of 1.8. The full gene was amplified with OsHDT701 gene primers and sequenced. Based on the OsHDT701 gene sequence, oligo single guide RNA (sgRNA) was generated by using the http://chopchop.cbu.uib programme. The target site for designing sgRNA was found from 168 basepair to 190 basepair with the deletion of a nucleotide at 174th position.
 
Among monocots, rice is considered as a significant stable crop and also an ideal plant for functional genomics studies. For more than 50% of the world's population, it is an important part of their diet. Production and consumption of rice have dramatically expanded worldwide, rising from 450 million tonnes in 2011 to 490 million tonnes in 2020 and then projected to rise to over 650 million tonnes by 2050 (Mishra et al., 2018). To fulfil the rising demand for rice due to the growing population, it is estimated that output will need to expand by 40% (Vladimir et al., 2017). Diseases occupy a prominent position in food security worldwide and agriculture development (Kangquan et al., 2019). Rice blast is caused by the ascomycete filamentous fungus named Magnaporthe oryzae and is believed to be one of the most destructive diseases affecting rice in all rice-growing countries. Apart from the conventional plant breeding technologies, new breeding strategy has been developed with genetic engineering to enhance the rice production by improved expression or by the removal of the function of the genes which codes for the major development in the rice crop (Halim et al., 2021).
              
HDT701, a member of the plant-specific HD2 subfamily of histone deacetylases (HDACs), performs a variety of functions, in rice (Oryza sativa L.) and majorly involves in the innate immunity system (Bo Ding et al., 2012). HDT701 Transcription increases in the compatible responses whereas it decreases in the incompatible responses after the infection with the fungal pathogen Magnaporthe oryzae. Modification of HDT701 gene in the rice cultivar is expected to obtain the plant with blast resistance. Crispr-cas9 is an encouraging gene editing tool for engineering improved agronomic traits (Fiaz et al., 2019) in rice through tissue culture and genetic transformation and to increase resistance towards biotic/abiotic stresses (Ahmad et al., 2020). Cas9 is a nuclease protein that led to the 20 nucleotide target DNA sequence by a single guide-RNA. The PAM sequence or the Protospacer Adjacent Motif is an ‘NGG’ motif found at the upstream following 20 nucleotides of the target DNA and this 20 nucleotide sequence in sgRNA work together to determine the accuracy of the target site (Zafar et al., 2019). The level of accuracy and specificity for knowing the target gene position depends on the sequence of sgRNA which was created based on the sequence of the target gene (reference sequence obtained from bioinformatics search). The designed sgRNA is then used for construction of the vector and then introduced into the target site of the plant cell. To edit the genes in the target site, sgRNA guides cas9 nuclease protein (Martin et al., 2012). Bioinformatics programmes can detect edit sites in the form of nucleotide changes to reduce off-target regions. The goal of this present study was to create single guide RNA from the sequence of rice cv. RPBio-226 DNA in order to pinpoint the position of the mutation as well as the change in the targeted region in the sequence of the gene.

The experiment was conducted in the molecular laboratory of PPR biotech Innovations Private Limited, Hyderabad in the year 2022. Materials include Oryza sativa L. cv. RpBio-226 DNA and suitable right and left primers for PCR analysis.
 
DNA isolation
 
Isolation of the rice genomic DNA was done by taking the leaf sample and by using a standard Cetyltrimethyl Ammonium Bromide (CTAB) method (Miftahudin et al., 2004). Quantification of DNA was performed to measure the concentration by using a NanoDrop Spectrophotometer.
 
Designing of a primer and oligo sgRNA OsHDT701 using bioinformatics software
 
UGENE Software version 40.0 is used to design the primer sequences (Konstantin et al., 2012). On the basis of the reference genome, the OsHDT701 gene sequence from Oryza sativa cv. Hwayoung is used as evidence. The complete database with the locus name MG715489 located on the 5th chromosome was obtained from rice NCBI. By using Bioinformatics CRISPR software tool CHOPCHOP version 3.0.0, The OsHDT701 oligo sgRNA was constructed using the OsHDT701 sequence from rice cv. RpBio-226.
 
PCR amplification for OsHDT701 gene
 
The 50 μl of PCR  composition was prepared consisting of 5.0 μl genomic DNA (50 ng/μl), 5 μl each of right and left primers (10 ng/μl), 10 μl of double distilled water and PCR Master mix of 25.0 μl contain Taq Polymerase enzyme, buffer, 4 mM MgCl2, 0.4 mM dNTPs. The PCR programme was set on the PCR equipment with an initial denaturation temperature at 95°C for 4 minutes and 30 cycles of denaturation at 95°C for 30 seconds, 55°C as an annealing temperature for 30 seconds and 72°C as an extension temperature for 30 seconds. The PCR run was subsequently terminated after 15 minutes at an extension temperature of 72°C. Out of 50 μl amplified PCR product, 10 μl of amplified PCR product was run on 1% agarose gel with 50x TAE at 100 V for 40 minutes in the electrophoreses unit. The gel was then stained with 5 μl of blue dye and is observed under BioRad-Gel Documentation Unit. The remaining 40 μl of  the amplified product was then sequenced.
 
Data analysis
 
Using the ClustalW tool, the OsHDT701 gene sequence of rice cv. RpBio-226 is matched with the referal sequence of rice cv. Hwayoung (Thompson et al., 1994). Search Tool for Basic Local Alignment (BLASTn) is performed in order to search rice databases for homologous nucleotide sequence.
 
Isolation of rice genomic DNA
 
Isolation of rice genomic DNA from rice leaves cv. RP Bio226 (Fig 1) was done successfully and the level of DNA purity was checked. The DNA purity ranged from 1.8 to 2.0 (260:280 nm) and DNA analysis resulted that the DNA isolated has a high purity, with an average concentration of 1377 (Table 1).
 

Table 1: DNA quantification of rice cv. RPBio 226.



Fig 1: Electrophoresis of rice cv. RPBio-226 DNA.


 
Gene amplification by PCR and sequence of OsHDT701 gene from rice cv. RPBio226
 
The ORF (Open reading frame) of the OsHDT701 gene sequence of Rice cv. RPBio226 has been successfully used to construct both forward (left) and reverse (right) primers (Table 2). Successful amplification of the gene validated the genomic DNA cv. Hwayoung's OsHDT701 gene sequence. An electrophoregram with a single thick band suggests that amplification was successful (Fig 2). The rice DNA amplicon size after using the OsHDT701F and OsHDT701R primers was 894 bp.
 

Table 2: Primer sequence used for OsHDT701 gene amplification.


 

Fig 2: Electropherogram of OsHDT701 gene amplification in rice with size of 894 bp.


 
HDT701 gene sequence of rice cv. RPBio226
 
cgaatggagttctggggtcttgaagtcaagcctggacagactgtcaaatgtgag cctgaagatgaacgctttttgcacctttctcaggctgctcttggggaatcaaagaaagg atctgacaat gcagtaatgt atgttaaaac tgatgatcaa aagctagtcattg gaaccct ctcagctgacaagttccctc aaatccagtt tgatttggtc tttgacaaa gagtttgagctgtcacacacttcaaagactgctagtgtgttcttttctggctacaaagttt cccagccggc tgaggaagat gaaatggatt ttgattctga agaagttgaa gatgaagagg aggaagaaaa gatcattcca gctcccagggcaaatggcaa agttgaaggg aaggaaaatg agcagaaaaa acaaggcaagacagattctt cagcttcaaa atcaaaggct gcagtgaatg acgatgatga tgatgatgaca gtgatgaggatgattctgaggacgaagatctttctcctgaggatgatgatgatgattcttctg aggatgattccagcgaagatgatgaggatgagagtgacgaggaagaaactcccaagaag ccagagactggaaagaggaaagtagctgaaattgtgttgaagacaccttcgtctgat aagaaagcaaagattgctacaccgtcaggccagaagacaggtgacaagaagggtgtcc atgtagcaactccacatccggcaaagcaggctagcaagacccccgtgaatgacaagt caaagagaagtccccaaaatccggtggtgggtcaatttcttgcaagtcatgcagcaaga cgttcaacagtgaaatggctctgcaatctcactcg aaggccaagcaccccgcc aagtga.
 
OsHDT701 Oligo sgRNA gene
 
Based on the sequence of the OsHDT701 gene sequence, the oligo single guide RNA (sgRNA) was generated using the http://chopchop.cbu.uib programme (Table 3). The knock-out action of oligo sgRNA was constructed as a negatively stranded DNA with 55 per cent of GC content, an efficiency value of 67.80 per cent with a self-complementarity of 0. The CHOPCHOP crispr was the online search tool used to determine and predict the mutational position and conformance between the sequence of oligo single guide RNA and the sequence of OsHDT701 gene in RPBio226 rice. The target site for designing sgRNA was found from 168 bp to 190 bp with the deletion of a nucleotide at 174th position (Fig 3).
 

Table 3: Oligo single guide RNA sequence to target the OsHDT701 gene mutation.


 

Fig 3: OsHDT gene amplification area alignment.


 
Prediction of OsHDT701 gene sequence position
 
BLASTn is the search engine on the NCBI website (www.ncbi.nlm.nih.gov), used to compare the gene sequence of OsHDT701 edited rice cv. RPBio226 to homologous database nucleotide sequences. The Expect value was found to be 0, the identity percentage was 100 and the query coverage was 100 per cent (Table 4). This result determines that the rice cv. RPBio226 OsHDT701 gene sequence is homologous to rice cv. Hwayoung. The ClustalW tool was used to align the two OsHDT701 gene sequences, confirming their similarity.
 

Table 4: BLASTn result of OsHDT701 sequence of RPBio226.


       
In our experiment, DNA isolated from our sample has high purity, which indicates no degraded DNA. Since the integrity and purity of the DNA isolated was high, genomic DNA of rice cv. RPBio226 was used as a template for amplification. Before creating sgRNA, we amplified the HDT gene sequence and double-checked its quality. sgRNA position and primer designing was done for HDT gene by utilising CHOPCHOP software version 3.0.0 (Halim et al., 2021). Although a list of primers can be produced, but the primer candidates were chosen depending on the position of the targeted sgRNA. Latest DNA targeting modulations, such as CRISPR activation/repression, targeted enrichment of loci for long-read sequencing and Cas9 repair outcome prediction, can also be known by this software (Kornel et al., 2019).
       
CHOPCHOP software was used to design oligo sgRNA. We used a specific action mode and a number of favourable characteristics, including GC content (per cent), low self-complementarity [0.10] and high efficiency [0%, 100%]. Hypothetically, establishment of CRISPR-Cas9 target require a complementary sequence between the oligo single guide RNA and the target region. In order to increase the likelihood of gene silencing, the developed oligo sgRNA was placed nucleotide 82 from the initiation codon (Fernando et al., 2019). The left primer starts from 35th nucleotide to 57th nucleotide with primer Tm value of 59.9 and showing an off targets value of 1 and coming to the right primer starts from 289th nucleotide to 311th nucleotide in the sequence with the primer Tm value of 59.6 with an off targets value of 1. The analysis of the HDT gene sequence from rice cv. RPBio226 revealed significant similarities to the HDT gene sequence from rice cv. Hwayoung.
In summary, Chop Chop was highly efficient in producing HDT701 gene editing positions in the rice genome. Oligo single guide RNA was created successfully and it was predicted to target and suppress the HDT gene in rice cv. RPBio226. When HDT701 gene is silenced in rice, histone H4 acetylation levels are increased, pattern recognition receptor and defense-related gene transcription is increased and this promotes resistance to M. oryzae.
Authors wish to thank PRR Biotech Innovations Private Limited, Mehdipatnam, Hyderabad, Telangana, India for providing laboratory facilities to this paper work as part of Ph.D thesis.
 
 
All Authors declare that they have no conflicts of interest.

  1. Ahmad, S., Wei, X., Sheng, Z., Hu, P., Tang, S. (2020). CRISPR/ Cas9 for development of disease resistance in plants: Recent progress, limitations and future prospects. Brief Functional Genomics. 19(1): 26-39.

  2. BoDing ., Bellizzi, M.D.R.,  Ning, Y.,  Meyers, B.C., Guo-Liang, W. (2012). HDT701, a histone H4 deacetylase, negatively regulates plant innate immunity by modulating histone H4 acetylation of defense-related genes in rice. Plant Cell. 24(9): 3783-3794.

  3. Fernando, M.R. and Anders, G. (2019). A CRISPR/Cas9: Development and application in rice breeding. Rice Science. 26(5): 265-281.

  4. Fiaz, S., Ahmad, S., Noor, M., Wang, X., Younas, A., Riaz, A., Riaz, A., Ali, F. (2019). Applications of CRISPR/Cas9 system in rice grain quality improvement: perspectives and oppurtunities, International Journal of Molecular Science. 20(4): 888. DOI: 10.3390/ijms20040888.

  5. Halim, I., Fendiyanto, M., Miftahudin, H. (2021). sgRNA design for DLT gene editing using CRISPR-Cas9 and in-silico 

  6. mutation prediction in Rice cv. Hawara Bunar, ICoBio 2021, IOP Conf. Ser.: Earth Environmental Science. 948 012083.

  7. Kangquan, Y. and Jin-Long, Q. (2019). Genome editing for plant disease resistance: Applications and perspectives, Philo sophical transactions of the royal society B. Biol Sci. 2019 Mar 4;374(1767):20180322. doi: 10.1098/rstb.2018.0322.

  8. Konstantin, O., Golosova, O., Fursov, M. (2012). Unipro UGENE: A unified bioinformatics toolkit, the UGENE team. Bioinformatics. 28(8): 1166-1167.

  9. Kornel, L., Tessa, G.M., Krause, M., Yamila, N., Cleuren, T.,  Tjeldnes, H., Valen, E. (2019). CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research. 47 (W1): 171-174.

  10. Martin, J., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., Charpentier, E. (2012). A programmable dual-RNA- guided DNA endonuclease in adaptive bacterial immunity. The Science. 337(6096): 816-21.

  11. Miftahudin,  S.G.J.,  Gustafson, J.P. (2004). Development of PCR- based codominant markers flanking the Alt3 gene in rye. Genome. 47(2): 231-8.

  12. Mishra, R., Kumar, R., Zhao, K.J. (2018). Genome Editing in Rice: Recent Advances, Challenges and Future Implications. Frontiers in Plant Science.  12, 57-68. doi: 10.1007/ s11816-018-0472-0.

  13. Thompson, J.D.,  Higgins, D.G.,  Gibson, T.J. (1994). CLUSTAL W: Improving the sensitivity of progressive multiple se quence alignment through sequence weighting, position- specific gap penalties and weight matrix choice, Nucleic Acids Research. 22(22): 4673-80.

  14. Vladimir, M. and Lubos, S. (2017). Asian Countries in the Global Rice Market, Acta Universitatis Agriculturae et Silviculturae  Mendelianae Brunensis. 65(2): 679-688.

  15. Zafar, S., Zaidi, S.S., Gaba, Y.,  Pareek, S.L. S., Dhankher, O.P., Li, X., Mansoor, S., Pareek, A. (2019). Engineering abiotic stress tolerance via CRISPR-Cas mediated genome editing. J. Exp Bot. 71: 470-479. 

Editorial Board

View all (0)