<div>Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources.&nbsp; 
 
Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. 
 
Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3&rsquo; end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.</div>

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

<div>Background: Genome-scale approaches have played a significant role in the analysis of evolutionary relationships. Because of rich polymorphisms, high evolutionary rate and rare recombination, mitochondrial DNA sequences are commonly considered as effective markers for estimating population genetics, evolutionary and phylogenetic relationships. Flying fishes are important components of epipelagic ecosystems. Up to now, only few complete mitochondrial genomes of flying fishes have been reported. In the present study, the complete mitochondrial DNA sequences of the Cheilopogon pinnatibarbatus japonicus and Hirundichthys rondeletii had been determined. 
 
Methods: Based on the published mitogenome of Cheilopogon atrisignis (GenBank: KU360729), fifteen pairs of primers were designed by the software Primer Premier 5.0 to get the complete mitochondrial genomes of two flying fishes. According to the reported data, the phylogenetic position of two flying fishes were detected using the conserved 12 protein-coding genes. 
 
Result: The complete mitochondrial genomes of Cheilopogon pinnatibarbatus japonicus and Hirundichthys rondeletii are determined. They are 16532bp and 16525bp in length, respectively. And they both consists of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, two ribosomal RNA (rRNA) genes and a control region. The OL regions are conserved in these two flying fishes and might have no function. From the tree topologies, we found C.p. japonicus and H. rondeletii clustered in a group. The findings of the study would contribute to the phylogenetic classification and the genetic conservation management of C.p. japonicus and H. rondeletii. &nbsp;</div>

<div>The Complete Mitochondrial Genomes of two Flying Fishes, Cheilopogon pinnatibarbatus japonicus and Hirundichthys rondeletii&nbsp;</div>

The polledness intersexual goat (PIS- -) (Capra hircus), deformed individuals, could have malformed reproductive organs and loss of reproductive function. Here, we first determined the complete mitochondrial genome of Chinese native polledness intersexual goat (PIS- -) is 16,640 nt in length, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes and a non-coding control region. As in other mammals and intrastrains, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes, which are encoded on the light strand. Its overall base composition is A: 33.5%, T: 27.3%, C: 26.1% and G: 13.1%. The complete mitogenome of the Chinese indigenous breed of goat could provide a basic data for further understanding the contribution of mitochondria in the sex-developmental mechanism, tissue and organ cell deformity of polledness intersexual goat via genomic compare.&nbsp;

Comparative analysis the variability of a complete mitochondrial genome of polledness intersexual goat (PIS- -) from China&nbsp;

Background: The mitochondrial genome serves as a pivotal molecular marker for delving into systematic relationships and adaptive mechanisms. The genus Eothenomys (Cricetidae: Arvicolinae) has consistently attracted attention due to its similar biological characteristics and the analysis of its mitochondrial genome offers a fresh perspective for comprehending the phylogeny and adaptation within Cricetidae. 
 
Methods: We sequenced and analyzed the entire mitochondrial genome of E. olitor and utilized the 13 PCGs derived from this genome to delineate the phylogenetic relationships within the Cricetidae and further evaluated the evolutionary rate of each PCG. 
 
Result: The findings revealed that the mitochondrial genome of E. olitor was 16,351 bp in length, including 13 PCGs with ATN initiation codons, 22 tRNAs, 2 rRNAs and 1 D-loop. Apart from the nad6 and 8 tRNAs positioned on the J-strand, the majority of the genetic elements were situated on the N-strand. The phylogenetic examination yielded a robust phylogenetic tree for Cricetidae, but the placement of some genera remained contentious, which needs more integrative and effective data. Among of them, E. olitor was a sister of E. chinensis and Eothenomys was monophyletic. Moreover, a selective analysis showed that evolutionary rates are significant differences among the 13 PCGs. Among these genes, atp8 a high evolutionary rate, while cox1 has a low. This research uncovered the mitochondrial genome analysis of E. olitor, offering valuable perspectives the phylogeny and adaptation within Cricetidae.

Phylogenetic Insights from the Mitochondrial Genome of Eothenomys olitor (Thomas, 1911): A Cricetidae Perspective

<div>Background: The present study was carried out for genetic characterization and assessment of evolutionary status of native cattle breeds of Tamil Nadu, India. 
 
Methods:&nbsp;Complete mitochondrial genome sequence of 15 pooled samples belonging to five cattle breeds of Tamil Nadu was carried out for the first time using Illumina platform. These mitogenomes were utilized in the present investigation to study the mitochondrial diversity. using suitable statistical tools.&nbsp; 
 
Result:&nbsp;The sequences encompassed 16,338 to 16,340 nucleotides with 273 variants. Low degree of genetic divergence and polymorphism was observed in the population. Higher rate of migrants (11.77) between populations caused increase in gene flow. FST value of -0.04435 revealed low level of genetic differentiation between cattle breeds of Tamil Nadu. A significant negative Tajima&rsquo;s D (P&lt;0.05) for all the Bos indicus cattle indicates operation of purifying selection and population expansion among the genetic groups under study. Maximum likelihood reconstruction using complete mitochondrial sequences of the present study combined with previously reported sequences of Nellore cattle and eight Bos taurus cattle breeds illustrated close genetic relationship among the Bos indicus cattle under study with a clear demarcation from the Bos taurus cattle indicating higher genetic divergence between the two lineages. This finding was also supported by multi-dimensional scaling. Analysis of molecular variance revealed no differentiation between cattle breeds of Tamil Nadu.</div>

​Elucidation of Genetic Divergence among Cattle Breeds of Tamil Nadu in Mitochondrial Genome

Background: Bangana dero is a cyprinid fish species that is classified under the subfamily Labeoninae. It occurs in the streams of China, India and Nepal near the foot of the Himalayan range. B. dero&rsquo;s whole mitochondrial genome has been sequenced and annotated. In this work, the tRNAs, protein-coding genes have been characterized and analyzed the phylogenetic relation of this fish with other cyprinid species. 
 
Methods: Nanopore sequencing was utilized to determine the entire mitochondrial genome of B. dero. Utilizing NEBNext Ultra DNA Library Prep Kit, end-repair was performed on the isolated DNA using the. Barcoding adapter ligation (BCA) and cleaned. Sequencing was done. All the long read bases were trimmed based on lowest base quality score, Q&lt;9. Barcode and adapters sequences were also trimmed using a porechop programme and the statistical graph illustrations were generated and genome assembly was done using Canu1.5. 
 
Result: The mitogenome is 16613 bp and contains 13 protein-coding genes, 2 rRNA genes,&nbsp; 22 tRNA genes, as well as a non-coding region. The nucleotide makeup is A=32.5%, T=25.21%, C=26.51% and G=15.77%, G + C = 42.28% and A+T=57.71%. The clover-leaf secondary structure was found in all tRNAs except tRNA-Ser2, which has no dihydrouridine arm. For 12 out of 13 protein-coding genes, the initiation codon was ATG, but COI used GTG. Methionine and tryptophan are unique among amino acids as they are each encoded by a single codon. Origin of light chain replication (OL) could fold into a hairpin secondary structure and carried a sequence 5&#39;-GGCGG-3&#39; in its stem. A long intergenic spacer of 46 bp was observed between tRNA-Leu1 and ND1. In the phylogenetic study, B. dero clustered closely with the Bangana species (AP013327) and Labeo boggut (NC_029450), a grouping supported by a bootstrap value of 100. This is the first study on the entire mitochondrial DNA analysis of B. dero.

&nbsp;

The Complete Mitochondrial Genome of Bangana dero (Cyprinidae: labeoninae) and its Relationship with Other Labeonin Fishes

Background: Animal body color was crucial for genetics and evolution, among which albinism was the result of genetic mutations and there were multiple genetic mechanisms that impede melanin synthesis, thereby affecting animal survival. Studying the phenomenon of albinism could help deepen our understanding of the secrets of genetic and species adaptive evolution. 
 
Methods: This study utilized high-throughput sequencing technology and bioinformatics analysis to investigate the mitochondrial genome of the albino Eothenomys eleusis Thomas 1911. The aim was to reveal its structural or compositional characteristics, phylogenetic locationand evolutionary rate. 
 
Result: The characteristic results indicated that the genome sequence (16,347 bp) contained 37 genes and a control region, with a few genes in the &ldquo;-&rdquo; chain and most genes in the &ldquo;+&rdquo; chain. The base composition and skewness of the whole genome exhibited a significant AT preference. Except for nad1 started with GTG and nad1, cox3 and nad4 ended with T (AA), most of the 13 PCGs followed standard genetic code rules. The most commonly used codons were CUA, AUCand AUA, while the relatively commonly used amino acids were Leu1, Ile and Thr. Numerous U-G mismatches were observed in the secondary structure of tRNAs. Phylogenetic analysis confirmed that albino E. eleusis was closely related to normal E. eleusisand Eothenomys was a monophyletic group. Evolutionary rate analysis suggested that atp8 and nd4l had higher dN/dS mean values, while cox1 and cox2 were the opposite. In conclusion, this study not only revealed for the first time the mitochondrial genome characteristics and phylogenetic relationships of albino E. eleusis, but also provided a new scientific basis and reference direction for the genetic characteristics, diversity and adaptive evolution of Eothenomys and other albino species.

A Rare Mitochondrial Genome of Albino Eothenomys eleusis Thomas 1911 (Cricetidae: Arvicolinae) from Southeastern Yunnan, China and its phylogenetic Analysis

Background: Codon usage bias is a widespread phenomenon in many organisms, including higher plants and plays an important role in regulating gene expression efficiency and accuracy. As an important forage species with high nutritional value, Medicago sativa (alfalfa) has been extensively utilized not only in traditional breeding but also in molecular genetic improvement. Understanding the characteristics of codon preference in its organelle genomes can provide valuable guidance for optimizing gene design and enhancing the expression of exogenous genes in alfalfa or related species. 
 
Methods: A total of 30 mitochondrial and 51 chloroplast high-quality coding sequences were obtained from the NCBI database. Codon usage patterns and preferences were analyzed using CodonW, R, MEGA and Excel. 
 
Result: The effective number of codons (ENC) in mitochondria ranged from 44.73 to 61.0, with an average GC content of 0.42 and GC content at the third codon position (GC3s) of 0.37. In chloroplasts, the ENC ranged from 38.90 to 57.76, with an average GC content of 0.37 and GC3s of 0.27. Analyses using ENC-plot, neutrality plot and PR2 bias analysis suggested that codon usage bias in Medicago sativa is influenced by both natural selection and mutation pressure. Twelve optimal codons were identified in mitochondria (mostly ending in &lsquo;A&rsquo; and &lsquo;U&rsquo;) and fourteen in chloroplasts, also showing a preference for &lsquo;A/U&rsquo;-ending codons. 
&nbsp;

Comparative Analysis of Mitochondrial and Chloroplast Genomes in Alfalfa (Medicago sativa L.)

<div>Mungbean is an important pulse crop and it is mainly cultivated in Asia for human consumption. Its small genome and diploid nature make it a well-suited model organism among legume crops. Thus, cost-effective, reliable and highly polymorphic molecular markers distributing the whole genome are needed for diversity, mapping and functional genomics studies in this model species. The whole-genome sequence of mungbean was obtained and used as a source of identification of simple sequence repeats (SSR). The sequence reads were aligned and SSRs detection was performed using the Phobos plugin tandem repeat finder in the Geneious software program. A total of 12 mungbean genotypes were selected to validate the newly developed SSR markers.&nbsp;In the present study, a total of 12, 49,774 and 11, 86, 386 perfect and imperfect SSR repeats were identified from the mungbean genome. The tri-repeats were the most abundant (26.10%), followed by hexa (20.82%), penta (20.45%), tetra (17.65%) and di-repeats (14.95%). We designed 1330 SSR primers based on the genomic sequence of flanking perfect SSRs (Di and tri-repeats). Among them, 50 SSR primers uniformly distributed across the 11 mungbean chromosomes were selected and used to validate 12 mungbean genotypes. The newly developed genomic SSR markers generated in the present study are a valuable genomic resource for the mungbean breeding programs.</div>

Development of Genome-wide Simple Sequence Repeat Markers from Whole-genome Sequence of Mungbean (Vigna radiata)

Background: Mitochondria are organelles called power plants of the cell, which are found in eukaryotic cells and are responsible for the production of energy needed by the cells through aerobic respiration. Mitochondrial dysfunction causes endocrinological, cardiovascular, metabolic and neurodegenerative diseases. The aim of this study was to examine the effects of body condition score (BCS), lactation, pregnancy, age and gender on Mitochondrial-Derived Peptide (MOTS-c) and Brain Mitochondrial Transporter Protein 1 (BMCP1) levels in Akkaraman sheep. 
 
Methods: Sheep are classified into 3 categories according to BCS (BCS&lt;2, BCS=3-3.5, BCS&ge;4). In creating groups in terms of BCS, it was determined by the palpation method applied to the waist area. The sheep included in the study were divided into 4 groups: early lactation, early pregnancy, late pregnancy (dry period) and age (female and male sheep).1st group, ewes in the first period of pregnancy (on the 100th day of the first pregnancy) (n = 30), 2nd group, ewes in the early lactation period (n = 30), 3rd group, ewes in the dry period (the last two months of pregnancy) (n = 30) and in the 4th group, &lt;2 (young) (n=30), 2-8 (adult) (n=30), 8&gt; (old) (n=30), male and female sheep (n=30) of different ages. =180) total of 270 animals. Blood samples were taken from the jugular vein of the sheep before the morning feeding. MOTSc and BMCP1 levels were determined in blood serum samples by ELISA method. 
 
Result: In the study, serum MOTS-c and BMCP1 levels in sheep during lactation and pregnancy were determined to be lowest in the VKS&lt;2 group and highest in the VKS&ge;4 groups. Likewise, in age and gender groups, the highest level was detected in young lambs and yearlings in the VKS&lt;2 group, while the highest level was detected in old sheep and rams in the VKS&ge;4 group. As a result, it was determined that different age, gender, pregnancy and lactation periods affected serum MOTS-c and BMCP1 levels depending on the change in BCS (P&lt;0.05). It was concluded that MOTS-c and BMCP1 may be useful parameters in the evaluation of mitochondrial function, energy metabolism and metabolic profile.

The Relationship of Mitochondrial-derived Peptide (MOTS-c) and Brain Mitochondrial Carrier Protein 1 (BMCP1) Response in Sheep with Some Physiological Parameters