Indian Journal of Animal Research

  • Chief EditorM. R. Saseendranath

  • Print ISSN 0367-6722

  • Online ISSN 0976-0555

  • NAAS Rating 6.40

  • SJR 0.233, CiteScore: 0.606

  • Impact Factor 0.4 (2024)

Frequency :
Monthly (January, February, March, April, May, June, July, August, September, October, November and December)
Indexing Services :
Science Citation Index Expanded, BIOSIS Preview, ISI Citation Index, Biological Abstracts, Scopus, AGRICOLA, Google Scholar, CrossRef, CAB Abstracting Journals, Chemical Abstracts, Indian Science Abstracts, EBSCO Indexing Services, Index Copernicus
Submit

Full Research Article

Molecular Typing of Staphylococcus aureus Isolated from Canine Pyometra

Dilna Sebastian1, Surya Sankar1,*, Binu K. Mani1, Hiron M. Harshan2
1Department of Veterinary Microbiology, College of Veterinary and Animal Sciences, Mannuthy, Thrissur-680 651, Kerala, India.
2Department of Animal Reproduction Gynaecology and Obstetrics College of Veterinary and Animal Sciences, Mannuthy, Thrissur-680 651, Kerala, India.

ABSTRACT

Background: Pyometra is a chronic disease condition in bitches, characterised by the accumulation of pus within the uterus. Multi-drug resistant bacterial strains with biofilm-forming ability are one of the most significant reasons behind the failure of medical management. The present study was envisaged for the detection of antibiotic resistance, biofilm-forming ability and molecular typing of S. aureus isolated from canine pyometra.

Methods: A total of 40 samples were collected from dogs with pyometra and following isolation and identification, DNA was extracted from the pure cultures of 13 coagulase positive Staphylococcus isolates.

Result: Six isolates turned out to be Staphylococcus aureus in nuc gene specific PCR and in antibiogram, all were found to be multidrug resistant. Out of the 13 staphylococcal isolates, eight turned out be positive for the presence of mecA gene, which included five S. aureus isolates. Out of 13 isolates, 53.8% were found to be strong biofilm producers in tissue culture plate method.  Among the 13 staphylococcal isolates, 53.8% showed the presence of icaD gene, whereas, 46.1% showed the presence of bap gene. All the six S.aureus isolates obtained in the study were subjected to agr typing by PCR and all belong to agr type I. All the isolates turned out to be belonging to spa type t037.

INTRODUCTION

Canine pyometra is a serious and life-threatening inflammatory condition, characterised by the accumulation of pus in the uterus. Although Staphylococcus spp. and Escherichia coli are associated with the majority of the infections, Klebsiella spp., Streptococcus spp. and Pseudomonas spp. are also linked to the illness ( Hagman, 2018; Chitra, 2024).   In case of valuable breeding bitches, medical management is most often resorted, with a long duration of antibiotic treatment, but recurrences are common. The significant reason behind this is the problem of antibiotic resistance. Among the various reasons implicated for this resistance, the ability of the bacterial organism to build biofilm is highly relevant (Robaj et al., 2016;  Amrutha et al., 2022).
       
Methicillin-resistant Staphylococcus aureus (MRSA) is a group of S. aureus that are genetically distinct from other strains and is responsible for several difficult-to-treat infections in humans. People who live near to animals, especially companion animals, may be more easily exposed to MRSA due to their proximity. Resistance to methicillin is mediated by the mecA gene, which encodes an altered penicillin-binding protein (PBP2a/PBP22 ) and is carried on the staphylococcal cassette chromosome mec element (SCCmec) (Goudarzi  et al., 2021). The biofilm-forming abilities have been thoroughly demonstrated in members of the genus Staphylococcus, such as S. epidermidis and S. aureus (Atshan et al., 2012). Among the various proteins associated with biofilm formation in S. aureus, apart from acting as virulence factors, proteins coded by icaA, icaD and bap genes plays a significant role (Salina et al., 2020). Pathogenic bacteria survive in different types of reservoirs, viz., humans, animals, water and food. Dissemination from these reservoirs produce clusters of colonization or infection, which is termed as outbreaks. In such conditions, typing is employed, either for surveillance of infectious diseases or in outbreak investigations.
       
To establish and maintain infection, S. aureus encodes several virulence factors and accessory gene regulator (agr) system is one among them, which regulates and controls the production of these virulence factors. Many genes involved in tissue colonisation and invasion are controlled by this system. agr I, agr II, agr III and agr IV are the four kinds of agr polymorphism that originate from mutation and/or insertions in agr C and agr D genes (Derakhshan et al., 2021). Spa typing has been extensively used as a typing tool for epidemiological investigations and some researches recommend it for outbreak investigations and detection of source of transmission (Strommenger et al., 2008). The typing relies on the assessment of number and sequence variation in repeats at the X region of the spa gene and it exhibits good discriminatory power and is very useful as it is easy to perform, cheap and have a standardized system of nomenclature (O Hara  et al., 2016).
       
So far, in Kerala no studies have been conducted in this regard on canine pyometra caused by S. aureus. Hence, the present study is envisaged in this direction. The study will throw light on the association between the 3 different molecular types of S. aureus, its biofilm forming potential and resistance profile.

MATERIALS AND METHODS

A total of 40 samples were collected from bitches with pyometra. The samples included guarded anterior vaginal swabs from cases of open pyometra and were collected from Kerala Veterinary and Animal Science University hospitals at Mannuthy and Kokkalai during the year 2023.  The samples were processed for bacterial isolation and identification employing standard microbiological procedures and the isolates were identified based on cultural, morphological and biochemical characteristics. Staphylococcus aureus DNA was extracted from one single colony employing commercial DNA extraction kit (HiPurA® Bacterial Genomic DNA Purification kit) according to the manufacturer’s instructions. Isolated DNA served as the template for the detection of the nuc gene. Primers using forward (5' -GCGATTGATGGTGATACGGTT-3' ) and reverse (5'-AGCCAAGCCTTGACGAACTAAAGC-3') sequences were used to amplify the S. aureus nuc gene.
       
The PCR program consisted of an initial denaturation step at 95oC for 5 min, denaturation in 35 Cycles of 60 s at 94oC, annealing at 55oC for 30 s and extension at 72oC for 90 s; and final extension in 1 cycle of 72oC for 10 min. The expected amplicon size was 270 bp.
 
Antibiogram
 
Kirby-Bauer disc diffusion method was performed on MHA plates to determine the susceptibilities of the isolates to different beta-lactam and non-beta-lactam antibiotics (CLSI, 2018).
       
Multiple antibiotic resistance index (MAR) of the isolates was calculated as the ratio of number of antibiotics to which organism is resistant to total number of antibiotics to which organism is exposed. The MAR index value greater than 0.2 indicate high risk source of contamination, where the antibiotics are often used. The susceptibility test of the isolates was done on MHA by Kirby Bauer disc diffusion method. Antibiotics used were cefoxitin and oxacillin. The zones of inhibition were measured and the results interpreted according to the guidelines of Clinical Laboratory Standard Institute (CLSI, 2018). Staphylococcus aureus DNA was extracted employing commercial DNA extraction kit. Amplification of mecA and mecC were performed using forward primer mecA-FP-AAAATC GATGGTAAAGGTTGGC and reverse primer mecA-RP- AGT TCTGC AGTACCGGATTTGC and mecC-FP- GAAAAAA AGGCTTAGAACGCCTC and reverse primer sequence mecC-RP-GAAGATCTTTTCCGTTTTCAGC (Goudarzi et al., 2021). PCR was performed as per the protocol described with minor modification with the following thermal cycling conditions: Initial denaturation at 95oC for 5 min followed by 35 cycles of amplification at 95oC for 30 s, 52oC for 60 s, 72oC for 60 s and final extension at 72oC for 10 min. PCR amplified a 533 bp fragment of the mec A and 138 bp fragment of mecC gene.
 
Detection of biofilm
 
Biofilm forming potential of the S.aureus isolates was determined quantitatively by tissue culture plate method, quantitative method was described by Christensen et al., (1985). Organism isolated from fresh agar plates were inoculated in 10 mL TSB with 1 per cent glucose. Broths were incubated at 37oC for 24 h. The cultures were then diluted to 1:100 with fresh medium. Individual wells of sterile 96 well flat bottom polystyrene tissue culture plates were filled with 200 μL of the diluted cultures. The positive control (E.coli) and negative control (fresh TSB with 1 per cent glucose) were also incubated, diluted and added to tissue culture plate. Negative control wells contained inoculated sterile broth. The plates were incubated at 37oC for 24 h. Contents of each well was removed by gentle tapping. The wells were washed with 0.2 M of phosphate buffer saline (pH 7.2) four times. Biofilm formed by bacteria adherent to the wells were fixed using 2 per cent sodium acetate and stained with 0.1 per cent crystal violet. Excess stain was removed using deionized water. Crystal violet remaining in the wells was then dissolved in 1mL of an ethanol/acetone solution. Optical density (OD) of stained adherent biofilm was obtained using microELISA auto reader at a wavelength 570 nm. The isolates showing an average OD value more than 0.240 were considered as strong biofilm producers.
 
Detection of virulence genes
 
The presence of the virulence genes icaA, icaD and bap associated with S. aureus isolates were detected employing  PCR. icaA F (5' - CCTAACTAACGAAAGGTAG -3'),  icaA R (5'- AAGATATAGCGATAAGTGC -3'), icaD F (5'-AAACGTAAG AGAGGTGG -3') icaD R (5' - GGCAATATGATCAAGATAC - 3'), bap F (5'- CCCTATATCGAAGGTGTAGAATTG -3') and bap R (5' - GCTGTTGAAGTTAATACTGTACCTGC - 3'). These primers allow the amplification of a 1315-bp DNA fragment for icaA, 381-bp DNA fragment for icaD and971-bp DNA fragment for bap. The primers used in the study for the detection of the virulence genes were selected as per Nemati et al., (2009). Amplifications were carried out in an MJ Mini Bio-Rad thermal cycler through the following temperature program for the amplification of icaA and icaD genes: 1 cycle of 5 min at 94oC; 30 cycles of 45 s at 94oC, 45 s at 55oC and 45 s at 72oC; and finally 1 cycle of 72oC for 10 min and for amplification of bap gene :1 cycle of 5 min at 94oC; 30 cycles of 45 s at 94oC, 45 s at 61.3oC and 45 s at 72oC; and finally 1 cycle of 72oC for 10 min. Amplification products were electrophoresed in a 1.5% agarose gel containing ethidium bromide and visualized by transillumination under UV.
 
Molecular typing of S. aureus
 
The presence or absence of the genes agr I, agr II, agr III and agr IV in S. aureus isolates was determined by constructing a quadruplex PCR. The quadruplex PCR was performed in a total volume of 20 µL reaction mixture. Pan (5 -ATG CAC ATG GTG CAC ATG C-3), agr I (5 - GTC ACA AGT ACT ATA AGC TGC GAT-3), agr II (5 -TAT TAC TAA TTG AAA AGT GGC CAT AGC-3 ), agr III (5 -GTA ATG TAA TAG CTT GTA TAA TAA TAC CCA G-3 ) and agr IV(5 -CGA TAA TGC CGT AAT ACC CG-3) (Kahl et al., 2005; Goudarzi et al., 2019). These primers allow the amplification of a 441-bp DNA fragment for agr I, of a 575-bp fragment for agr II, a 323-bp fragment for agr III and a 659-bp fragment for agr IV strains. Amplifications were carried out in an MJ Mini Bio-Rad thermal cycler through the following temperature program: 1 cycle of 5 min at 94oC; 30 cycles of 30 s at 94oC, 30 s at 55oC and 60 s at 72oC; and finally 1 cycle of 72oC for 10 mins. Primers spa F (5’- TAAAGACGATCCT TCGGTGAGC- 3’) and spa R (5’ - CAGCAGTAGTGCCGTTT GCTT - 3’) were used to amplify a portion of spa gene (products variable 100 - 600 bp). The PCR program consisted of an initial denaturation step at 80oC for 5 min, denaturation in 35 cycles of 45 s at 94oC, annealing at 600C for 45 s and extension at 72oC for 90 s; and final extension in 1 cycle of 72oC for 10 min.

RESULTS AND DISCUSSION

A total of 40 samples, Gram’s staining revealed that 17 isolates were Gram positive and 23 were Gram negative bacilli. The 13 samples were produced white or yellow large smooth colonies on BHIA with positive reaction for catalase, methyl red, VP, citrate utilisation, urease and coagulase test and negative results for indole production and oxidase test. All of them, which produced yellow coloured colonies on MSA and tube and slide test positive for coagulase, were confirmed as coagulase positive Staphylococcus spp. The nuc gene specific PCR for S. aureus was carried out with the DNA of 13 coagulase positive Staphylococcus isolates and 46.1% turned out to be positive for S. aureus (Fig 1). Brakstad et al.  (1992), employed PCR targeting the region of the nuc gene, that specifically codes for the thermostable nuclease seen in S. aureus, for the specific identification of the species.

Fig 1: Agarose gel electrophoresed image of nucgene of Staphylococcus aureus.


       
The 32.5% Staphylococcus spp. obtained in the study were subjected to antibiogram employing the 20 antibiotics, commonly employed for the therapy of infections in dog. All the isolates were found to be MDR, showing resistance to at least two classes of antibiotics. Similar findings were documented by Amrutha et al., (2022), who used the typical antibiotics used to treat pyometra to antibiogram the isolates. While 100% of S. aureus isolates were resistant to amoxy-clav, ceftriaxone, ceftriaxone-tazobactam, ciprofloxacin, gentamicin and metronidazole, 50% of them were sensitive to tetracycline, followed by enrofloxacin (37.5%) and co-trimoxazole (25%). Subramani and Vignesh (2012) conducted a study on the MAR index of the S. aureus isolates from clinical pus samples, using 17 distinct antibiotics, belonging to the class β-lactams, aminoglycosides  and quinolones. The study recorded that 50 per cent of the isolates were MDR and every isolate had an extremely high MAR Index, indicating that the isolates were likely originated from areas with extensive antibiotic use.  Phenotypic characterisation of the isolates employing oxacillin disc diffusion test, among the 13 Staphylococcus isolates, 69.2% showed resistance to methicillin on oxacillin disk diffusion test, which included 66.6% S. aureus and 33.3% other coagulase positive Staphylococcus spp and 30.7% coagulase positive Staphylococcus spp. All the 13 isolates were subjected to PCR targeting the mecA and mecC genes and 61.5% turned out be positive for the presence of mecA gene, which included fiveS. aureus isolates and three other coagulase positive Staphylococcus spp. 38.4% isolates did not show the presence of mecA gene (Fig 2). None of the isolates were positive for the presence of mecC gene. One coagulase positive Staphylococcus spp. which showed resistance phenotypically, gave negative results for the presence of mecA gene. Similar observations were documented by Abdelwahab et al., (2023) in a study on the phenotypic and genotypic characterisation of methicillin resistance in Staphylococci isolated from an Egyptian University Hospital. If a Staphylococcus spp. is methicillin and oxacillin resistant phenotypically, but genotypically negative for mecA gene, it could be due to the presence of mecC gene, which is a homolog of mecA gene and is also responsible for methicillin resistance in some staphylococcal isolates. A study on MRSA screening in S. aureus by Becker et al., (2018), documented that a mecB homolog with 60% nucleotide sequence similarity to the originally identified mecA gene of S. aureus could also be responsible for methicillin resistance in the isolates that tested negative for mecA and mecC. Also, Ba et al., (2014), mentioned that specific alterations in different amino acids present in protein binding proteins cascade (PBPs 1, 2 and 3) might also be the basis of methicillin resistance.

Fig 2: Agarose gel electrophoresed image of mecA gene of Staphylococcus aureus.

        

Out of the 13 isolates, 53.8% were found to be strong biofilm producers in tissue culture plate method (Table 1). Mishra et al., (2015), conducted studies for comparing the different methods for detection of biofilm formation in clinical isolates of S. aureus from indwelling medical devices and out of 67 isolates, 31 (46.3 per cent) were found to be biofilm producers and 36 (53.7 per cent) were non-biofilm producers by tissue culture plate method. The study documented that tissue culture plate method is the gold standard method for the detection of biofilm producers and in addition, they recommended tissue adherence method for routine detection of biofilm production in countries, where molecular methods and sophisticated microscopy techniques are constrained. The presence of virulence genes associated with biofilm formation, icaA, icaD and bapamong the Staphylococcus spp. were detected employing PCR. All the six S.aureus isolates and one coagulase positive Staphylococcus spp. showed the presence of icaD gene, whereas, five S.aureus and one coagulase positive Staphylococcus spp. showed the presence of bap gene (Fig 3). None of the isolates revealed the presence of icaA gene. Similar results were reported by Grinholc et al., (2007) in a study, who documented that 91 per cent of MRSA strains harbored icaD gene and in contrary, all icaD negative strains wereicaA positive. Nourbakhsh  et al. (2016) in a study on the phenotypic and genotypic characterization of biofilm formation in MRSA, documented that icaC gene had the highest frequency among them, followed by icaD.

Table 1: Optical density values in tissue culture plate method for biofilm detection of Staphylococcus spp. at 590 nm.



Fig 3: Agarose gel electrophoresed image of bap and icaD gene of Staphylococcus aureus.

        
        
All the six S.aureus isolates obtained in the study were subjected to agr typing by PCR followed by nucleotide sequencing.  All the isolates in the present study were found to be belonged to agr type I (Fig 4). Bibalan et al., (2014), who evaluated the agr types of S. aureus, obtained from patients, health care workers and food products, to assess the possible relationship between agr groups and infection types and the study reported that majority of the isolates belonged to agr I, followed by agr III, II and IV.All the six S.aureus isolates obtained in the study were subjected to spa typing by PCR followed by nucleotide sequencing of the representative amplicons. The sequences were submitted to spa Typer online software (http://spatyper.fortinbras.us/). The results were then compared to an online website for world spa types (Ridom spa Server, https://www.spaserver.ridom.de/).The isolates turned out to be belonged to spa type t037 (Fig 5). Singh et al., (2018) conducted a study on molecular epidemiology of MRSA, which identified 29 MRSA isolates with 9 unique spa types, with t037 (n = 6) and t045 (n = 6) being predominant, which was in accordance with the results of the present study.

Fig 4: Agarose gel electrophoresed image of agrgene of Staphylococcus aureus.



Fig 5: Agarose gel electrophoresed image of spa gene of Staphylococcus aureus.


       
The linkage between antibiotic resistance shown by the S. aureus isolates, their biofilm forming potential and the molecular types to which they belonged was assessed.  All the isolates were found to be MDR, five of them were MRSA and three were strong biofilm formers. All the isolates belonged to agr type I and spa type t037. Since the number of S. aureus isolates obtained in the study was less and all the isolates belonged to same agr type and spa type, the linkage between the antibiotic resistance, biofilm forming potential and molecular types of the isolates could not be deducted (Table 2). Asadollahi et al., (2018) conducted a study on available literatures to identify the most prevalent spa types among clinical isolates of MRSA and methicillin susceptible S.aureus around the world and documented that the most prevalent spa types identified in Asia were t037 and t002 and majority of the isolates under the type t037 were MRSA. Rofik et al., (2024) conducted a study on the characterisation of biofilm formation in uropathogenic S. aureus and their association with antibiotic resistance and reported that 55 per cent were found to be MDR and MRSA. In addition, all the strains were biofilm producers and a significant correlation was observed between MDR and non-MDR strains in terms of biofilm production. A study on genotypic characterisation of S. aureus isolated from a burn centre using agr, spa and SCCmec typing methods was conducted by Abbasian et al., (2018). The study documented that among the MRSA isolates, 78.4 per cent were characterised as agr type I and spa types t030 and t037 constituted the first and second most predominant   spa types found in 56.4  per cent and 25.6 per cent of isolates, respectively. Cafiso  et al. (2007) in a study examined the relationship between the development of biofilm and the accessory gene regulator (agr) in 29 strains of S. aureus isolated. Compared to other agr types, agr type II strains exhibited much higher biofilm-forming abilities.

Table 2: Linkage between antibiotic resistance, biofilm forming potential and molecular types of S. aureus isolates.

CONCLUSION

In the present study, all the S. aureus isolates obtained were found to be MDR and five of them were MRSA strains with biofilm-forming abilities, a significant factor behind the complications in the medical management of pyometra with recurrence. All the isolates were found to be agr type I and spa type t037. Since many researches have documented that many of the MRSA isolates from human belonged to agr type I and spa type t037 and considering the fact that companion animals live in close contact with the human environment, these strains are a major public health concern, causing life-threatening complications in the therapy of clinical infections in  human and animals.

ACKNOWLEDGEMENT

Authors acknowledge the Dean, College of Veterinary and Animal Sciences, Mannuthy for providing the necessary facilities needed for the study.

CONFLICT OF INTEREST

All authors declared that there is no conflict of interest.

REFERENCES


  1. Abbasian, S., Farahani, N.N., Mir, Z., Alinejad, F., Haeili, M., Dahmardehei, M., Mirzaii, M., Khoramrooz, S.S., Nasiri, M.J.,  Darban-Sarokhalil, D. (2018). Genotypic characterization of Staphylococcus aureus isolated from a burn centre by using agr, spa and SCCmec typing methods. New microbes and new infections. 26: 15-19.

  2. Abdelwahab., Marwa, A., Wesam, H.A., Elsharawy, D.R.M., Elkolaly,  Helal, R.A.E.F., Malla, D.A.E., Elfeky, Y.G.,  Bedair, H.A., Amer, R.S.,  Abd-Elmonsef, M.E. (2023). Phenotypic and Genotypic Characterization of Methicillin Resistance in Staphylococci Isolated from an Egyptian University Hospital. Pathogens. 12: 556.

  3. Amrutha, M.S., Sankar, S., Mani, B.K., Harshan, H.M., Vidya., Paulson, S.T. (2022). Detection of biofilm formation by Escherichia coli and 94 Staphylococcus aureus associated with canine pyometra. Indian Journal of Animal Research. 58(4): 648-653. doi: 10.18805/IJAR.B-4923.

  4. Asadollahi, P., Farahani, N.N., Mirzaii, M., Khoramrooz, S.S., van Belkum, A., Asadollahi, K., Dadashi, M., Darban-Sarokhalil, D. (2018). Distribution of the most prevalent Spa types among clinical isolates of Methicillin-resistant and -Susceptible Staphylococcus aureus around the World: A review. Frontiers in Microbiology. 9:163.

  5. Atshan, S.S. and Shamsudin, M.N. (2011). Evaluation of phenotypic and genotypic detection methods for biofilm-forming methicillin-sensitive and methicillin-resistant Staphylococcus aureus clinical isolates. Annals of Microbiology. 61: 825-831.

  6. Ba, X., Harrison, E.M., Edwards, G.F., Holden, M.T., Larsen, A.R., Petersen, A., Skov, R.L., Peacock, S.J., Parkhill, J., Paterson, G.K., Holmes, M.A. (2014). Novel mutations in penicillin-binding protein genes in clinical Staphylococcus aureus isolates that are methicillin resistant on susceptibility testing, but lack the mec gene. The Journal of Antimicrobial Chemotherapy. 69(3): 594-597.

  7. Becker, K., van Alen, S., Idelevich, E.A., Schleimer, N., Seggewiß, J., Mellmann, A., Kaspar, U.,  Peters, G. (2018). Plasmid- encoded transferable mecB-Mediated methicillin resistance in Staphylococcus aureus. Emerging Infectious diseases. 24(2): 242-248.

  8. Bibalan, M.H., Shakeri, F., Javid, N., Ghaemi, A., Ghaemi, E.A. (2014). Accessory gene regulator types of Staphylococcus aureus Isolated in Gorgan, North of Iran. Journal of Clinical and Diagnostic Research. 8(4): DC07-DC9.

  9. Brakstad. O.G, Aasbakk. K., AMaeland, J. (1992). Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. Journal of Clinical Microbiology.  30(7): 1654-1660.

  10. Cafiso, V., Bertuccio, T., Santagati, M., Demelio, V., Spina, D., Nicoletti, G., Stefani, S. (2007). Agr-Genotyping and transcriptional analysis of biofilm producing Staphylococcus aureus. FEMS Immunology and Medica; Microbiology. 51(1): 220-227.

  11. Chitra, P. (2024). Microbiological and Haemato-biochemical Studies in Canine Pyometra. Indian Journal of Animal Research. doi: 10.18805/IJAR.B-5441.

  12. Christensen, G.D., Simpson, W.A., Younger, J.J., Baddour, L.M., Barrett, F.F., Melton, D.M., Beachey, E.H. (1985). Adherence of coagulase negative staphylococci to plastic tissue culture plates: A quantitative model for the adherence of staphylococci to medical devices. Journal of Clinical Microbiology. 22: 996-1006.

  13. Clinical and Laboratory Standards Institute. (2018). Performance Standards for Antimicrobial Susceptibility Testing; 28th international supplement M100S21. Wayne, PA: CLSI.

  14. Derakhshan, S., Navidinia, M., Haghi, F. (2021). Antibiotic susceptibility of human-associated Staphylococcus aureus and its relation to agr typing, virulence genes and biofilm formation.  BMC Infectious Diseases. 21: 627.

  15. Goudarzi, M., Navidinia, M., Dadashi, M., Hashemi, A., Pouriran, R. (2021). First report of methicillin-resistant Staphylococcus aureus carrying the mecC gene in human samples from Iran: Prevalence and molecular characteristics. New microbes and new infections. 39:100832.

  16. Goudarzi, M., Mohammadi, A., Amirpour, A., Fazeli, M., Nasiri, M.J., Hashemi, A. and Goudarzi, H. (2019). Genetic diversity and biofilm formation analysis of Staphylococcus aureus causing urinary tract infections in Tehran, Iran. Journal of infection in developing countries. 13(9): 777-785. 

  17. Grinholc, M., Wegrzyn, G. Kurlenda, J. (2007). Evaluation of biofilm production and prevalence of the icaD gene in methicillin- resistant and  methicillin susceptible Staphylococcus aureus strains isolated from patients with nosocomial infections and carriers. FEMS Immunology and medical Microbiology. 50: 375-379.

  18. Hagman R. (2018). Pyometra in small animals. The veterinary clinics of North America. Small Animal Practice. 48(4): 639-661.

  19. Kahl, B.C., Belling, G., Becker, P., Chatterjee, I., Wardecki, K., Hilgert, K., Cheung, A.L., Peters, G. and Herrmann, M. (2005). Thymidine- dependent Staphylococcus aureus small-colony variants are associated with extensive alterations in regulator and virulence gene expression profiles. Infection and immunity. 73(7): 4119-4126. 

  20. Matussek, A., Taipalensuu, J., Einemo, I.M., Tiefenthal, M., fgren, S.L. (2007). Transmission of Staphylococcus aureus from maternity unit staff members to newborns disclosed through spa typing. American Journal of  Infection Control. 35: 122-125.

  21. Mishra, S.K., Basukala, P., Basukala, O., Parajuli, K., Pokhrel, B.M., Rijal, B.P. (2015). Detection of biofilm production and antibiotic resistance pattern in clinical isolates from indwelling medical devices. Current Microbiology. 70: 128-34.

  22. Nemati, M., Hermans, K., Devriese, L. A., Maes, D.,  Haesebrouck, F. (2009). Screening of genes encoding adhesion factors and biofilm formation in Staphylococcus aureus isolates from poultry. Avian Pathology: Journal of the W.V.P.A. 38(6): 513-517.

  23. Nourbakhsh. and Namvar, A.A. (2016). Detection of genes involved in biofilm formation in Staphylococcus aureus isolates. GMS Hygiene and Infection Control. 11: Doc07.

  24. O’Hara, F.P., Suaya, J.A., Ray, G.T., Baxter, R., Brown, M.L., Mera, R.M. (2016). Spa typing and multilocus sequence typing show comparable performance in a macroepidemiologic study of Staphylococcus aureus in the united states. Microbial Drug Resistance. 22: 88-96.

  25. Rafik, A., Asmaa, D., Habiba, R., Amina, R., Kaotar, N., Mohammed, T., Berrougui, H., Abdelouahed, K., Abouddihaj, B. (2024). Characterization of biofilm formation in uropathogenic Staphylococcus aureus and their association with antibiotic resistance. The Microbe. 2: 2950-1946

  26. Robaj, A., Sylejmani, D., Hamidi, A. (2016). Occurrence and antimicrobial susceptibility of bacterial agents of canine pyometra. Indian Journal of Animal Research. 52(3): 397-400. doi: 10.18805/ijar.v0iOF.6830.

  27. Salina, A., Guimarães, F.F., Pereira, V.B.R., Menozzi, B.D., Rall, V.L.M.,  Langoni, H. (2020). Detection of icaA, icaD and bap genes and biofilm production in Staphylococcus aureus and non-aureus staphylococci isolated from subclinical and clinical bovine mastitis. 72: 1034-1038

  28. Singh, G., Broor, S., Agarwal, priti. (2018). Molecular characterisation Of Staphylococcus aureus using spa typing as A diagnostic tool In Haryana, India. Indian Journal of Medical Microbiology. 36(1) : 26.

  29. Strommenger, B., Braulke, C., Pasemann, B., Schmidt, C. and Witte, W. (2008). Multiplex PCR for rapid detection of Staphylococcus aureus isolates suspected to represent community-acquired strains. Journal of clinical microbiology. 46(2): 582-587.

  30. Subramani, S., Vignesh, A. (2012). MAR index study and MDR character analysis of a few golden Staphylococci isolates.  Asian J. Pharm. Life Sci. 2(2): 151-154.
Reviewed By

Download Article
In this Article
    Contact us
    Follow us

    Editorial Board

    View all (0)